<?xml version="1.0" encoding="utf-8"?>

<rss version="2.0" xmlns:media="http://search.yahoo.com/mrss/" xmlns:atom="http://www.w3.org/2005/Atom" xmlns:creativeCommons="http://backend.userland.com/creativeCommonsRssModule">
    <channel>
        <title>deviantART: by:juusan-kika</title>
        <link>http://search.deviantart.com/?q=by:juusan-kika&amp;section=today</link>
        <description>deviantART RSS for by:juusan-kika</description>
        <language>en-us</language>
        <copyright>Copyright 2009, deviantART.com</copyright>

        <pubDate>Thu, 17 Dec 2009 03:59:56 PST</pubDate>        
        <generator>deviantART.com</generator>
        <docs>http://blogs.law.harvard.edu/tech/rss</docs>
        <atom:icon>http://s.deviantart.com/minish/widgets/apple-touch-icon-precomposed.png</atom:icon>
        <atom:link href="http://backend.deviantart.com/rss.xml?q=by%3Ajuusan-kika&amp;type=journal" rel="self" type="application/rss+xml" />
                  <item>
                <title>Now i wait...</title>
                <link>http://juusan-kika.deviantart.com/journal/28579532/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/28579532/</guid>
                <pubDate>Wed, 25 Nov 2009 23:26:52 PST</pubDate>
                
                <description><![CDATA[ Applications are sent to the colleges and now i wait 3-4 weeks and in some cases even longer. I fixed the unknown fee that kept the school from sending my transcript. A fee slipped by, when you're a senior you want to hear that you have fees a few weeks after you get them not a few weeks after you tell them to send the transcript and they say "wait we can't do it you have outstanding fees!" Thanks guys, what the hell is with all the fees anyway? i thought it was about education, i go to a public school and there are too many fees!<br /><br />I'm positive it gets spent on the sport teams.<br /><br />Now i wait... Ringling is my number one choice for college but i'll be jumping with joy if i get into SVA too. Cross your fingers for me!<br /><br />Off topic- My older sister got Assassin's Creed for the PC and i am fully addicted! It's fun go buy it! NOW! The sequel just came out (well... not for the PC) and it's apparently even better. Very addicting, i'm not the biggest gamer either but i'm guessing the gamers out there are all, you started 1 when 2 just came out?<br /><br />Beautiful graphics and animation (japan can kiss canada's ass) ... <a href="http://www.deviantart.com/users/outgoing?http://www.youtube.com/watch?v=mVWhWsgHzKM">[link]</a> at 3:10 you can see sweat on the guy's face! And the game looks SO fun!<br /><br />HOLY CRAP IT'S MIDNIGHT HERE!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>5000 pageviews</title>
                <link>http://juusan-kika.deviantart.com/journal/28156259/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/28156259/</guid>
                <pubDate>Thu, 05 Nov 2009 07:24:38 PST</pubDate>
                
                <description><![CDATA[ Yay! But my goal was to reach 10,000 by the end of the year. Well i went past my watcher goal.<br /><br />I am sending out my portfolio to colleges soon. So give me some tips! They require live-drawing so Cow, Megan Portrait, Contour Portrait, and Swine Flu are in and irremovable.<br /><br />Now I'm thinking on putting in Raise the Dead (after i edit it,) the Wife, Insignificant (after i crop it more,) Hybrid Wolf, Fisherman's calm, (maybe The Rat) and Kunic. I have two that i want to finish for this as well. Give input please!<br /><br />Wicked snowfall last week I made a snow couch! It melted in 3 days.If you want to see amazing art look at James Jean's new work for the show in LA. I'm not from LA if you haven't already guessed with the "wicked snowfall" still happy. <a href="http://www.deviantart.com/users/outgoing?http://www.jamesjean.com/">[link]</a><br /><br />There are FOUR Clint Eastwood movies on Hulu right now, yay!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Halloween! ... and such.</title>
                <link>http://juusan-kika.deviantart.com/journal/27821690/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/27821690/</guid>
                <pubDate>Sat, 17 Oct 2009 18:20:23 PDT</pubDate>
                
                <description><![CDATA[ There are so many good movies out now, in fall, where were they in the summer, bums me out that i can't see all of them.<br /><br />I've actually been trying to get some work as an illustrator/colorist recently. It's not going so well and i'm willing to work free! (it looks crazy good for you if you're a student, i would take it just as seriously as if I was paid) so if anyone knows if there's someone that needs art please note me! This idea came to me when i was looking at some excellent illustrations, and then i saw some not so excellent illustrations and the rest is obvious "Gee, i could do that!"<br /><br />I'm gonna make a forum in Services as soon as finish the halloween pic.<br /><br />.hire me.<br /><br />AP art goig well I need to try and make sure everything is varied (graphite, inks, markers) because I really want to do all digital! self restraint!<br /><br />I'm applying to college in November, yes i do feel very nauseated.<br /><br />Question: How do your mom to stop watching infomercials?<br /><br />Happy Halloween!<br /><br />Brains.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Under Great White Northern Lights</title>
                <link>http://juusan-kika.deviantart.com/journal/27098736/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/27098736/</guid>
                <pubDate>Tue, 08 Sep 2009 16:22:15 PDT</pubDate>
                
                <description><![CDATA[ In ten days Under Great White Northern Lights is coming to Toronto! If it ever comes to anywhere in the Colorado i'll be there! Well except nothing good ever comes to Colorado... Unlike Blackpool lights this is a Documentary! Which is excellent, because i want to know every bit about the genius of The White Stripes!<br /><br />The White Stripes have not released ANY info on the film, i'm not surprised they did but i'm still eager!<br /><br />UPDATE<br />I've been a couple weeks into school. Meh, already feels like I'm in a rut.<br />AP Art has me working so don't worry art will come flooding<br />Oh yeah ALL of my watchers ignored the anime pic, i just colored it give me a break!<br /><br />And from now on i'm only buying products that have not been animal tested. <br /><br /><a href="http://ivorykeys0821.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/i/v/ivorykeys0821.jpg?4" alt=":iconivorykeys0821:" title="ivorykeys0821"/></a> needs to gets some art up...<br /><br />UNDER GREAT WHITE NORTHERN LIGHTS!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>I'm Sorry!</title>
                <link>http://juusan-kika.deviantart.com/journal/26923029/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/26923029/</guid>
                <pubDate>Sun, 30 Aug 2009 19:05:54 PDT</pubDate>
                
                <description><![CDATA[ I've kinda been... neglecting deviantart.<br /><br />So time to get back on track! Before anyone says i haven't done anything in months i'd like to correct them and say that i have been making art just not uploading it. And i'll fix that!<br /><br />I've also been looking at some old ideas and i've decided to give them another chance... (Cyber-Fairy, Kinetic-Maid, didn't i say i was gonna do a somethin-centuar?)<br /><br />I think i will enter the 9 creature contest and i think (just like my last two contests) i will not get any attention at all for my submissions, still gonna do it, it's cool.<br /><br />If NONE of these ends up happening by the end of september i would like somebody to yell at me ("MOVE YOUR LAZY ASS!")<br /><br />Sorry again and don't give up on me!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>I'M HOME!</title>
                <link>http://juusan-kika.deviantart.com/journal/26387177/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/26387177/</guid>
                <pubDate>Tue, 04 Aug 2009 18:29:33 PDT</pubDate>
                
                <description><![CDATA[ You probably didn't notice i left because, i didn't really make an anouncement but i was is boston for the past month (too long) and lets see what you guys missed out on...<br /><br />I had my birthday, 17 woot! It wasn't so great, on the plus side family said they'd make up for it when we got home. Down side is they haven't yet and they probably aren't since august is get ready for senior year madness time...(i just want coconut cake!) but hey I'm 17 R rated movies and such... <br /><br />My phone is dead, i went a full month without my cellphone and i might end up going another month...<br /><br />That movie dead snow i got excited over, didn't come to my town.<br /><br />I saw the SHEPARD FAIREY exhibit in boston! WOW! SHEPARD FAIREY! Freakin AWESOME news!<br /><br />The highschool used to be 10-12, this year it's turning into 9-12... One side of me doesn't want to hate the freshman after all they're probably gonna come in scared... then again i remember how the sophomores would drive me crazy, they're like energizer rabbits, they don't stop! And how the freshman are even younger and have even more energy. The other side of me wants to step on them.<br /><br />Well i guess you know whats next: arts, stress, college, doing nothing ... Oh ya will someone help me with this new portfolio thingy on dA?<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>i've been infected... well tagged</title>
                <link>http://juusan-kika.deviantart.com/journal/25163649/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/25163649/</guid>
                <pubDate>Sat, 06 Jun 2009 14:54:33 PDT</pubDate>
                
                <description><![CDATA[ I have been tagged by <a href="http://vulture34.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/v/u/vulture34.gif" alt=":iconvulture34:" title="vulture34"/></a> i usually ignore these spam but let's go.Some facts about me.<br /><br />Rules:<br /><br />1) Post these rules.<br />2) Each person tagged must put eight random facts about themselves.<br />3) Tagged ones should write a journal about these facts.<br />4) At the end of the post tag eight more deviants<br />5) Go to their page telling them they're tagged.<br />6) No tagging back for the obvious reasons.<br /><br />1)I have citizenship to 3 different countries, i have no political future. <br />2)I used to sneak down and watch my dad's action movies when i was 6/7 to this day is still can't remember if my first R movie was Terminator2 or Spawn.<br />3)In middle school i accidently kneed myself in the face and got a bloody nose. Figures, i'm the one that gives me bloody nose.<br />4) I finished the SAT today! HOORAH! Except if i get less than 1800 i will retake for 3 1/2 more hours in october... <br />5)Once when i was skiing down this steep trail i lost balance and tumbled all the way down. My skiis were 15 feet away from me, and i didn't even get a bruise. I am INVINCIBLE<br />6) The elephant is my favorite animal, <b>certain</b> people think it's a rat, but i only drew that cause of Banksy... so yeah clarification.<br />7) I am hoping for scholarship to help me get into ringling so you guys really need to critique me to be helpful.<br />8) Eight is my lucky number! It's is the luckiest number ever, it  was elvis's lucky number. I have seen more movies in theatre 8 than any other number! The only reason why i did this was cause of the number 8<br /><br />And i tag...<br /><a href="http://atsumi-chick.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/a/t/atsumi-chick.jpg" alt=":iconatsumi-chick:" title="atsumi-chick"/></a> <a href="http://korkfish.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/k/o/korkfish.png" alt=":iconkorkfish:" title="korkfish"/></a> <a href="http://ivorykeys0821.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/i/v/ivorykeys0821.jpg?4" alt=":iconivorykeys0821:" title="ivorykeys0821"/></a> <a href="http://chaifox.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/c/h/chaifox.gif" alt=":iconchaifox:" title="chaifox"/></a><br /><a href="http://girwanttaco.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/g/i/girwanttaco.gif?1" alt=":icongirwanttaco:" title="girwanttaco"/></a> <a href="http://golden-leaves.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/g/o/golden-leaves.gif?3" alt=":icongolden-leaves:" title="golden-leaves"/></a> <a href="http://kiaramalfoy.deviantart.com/"><img class="avatar" src="http://a.deviantart.net/avatars/k/i/kiaramalfoy.jpg?1" alt=":iconkiaramalfoy:" title="kiaramalfoy"/></a> someone else, who want's it?<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Død snø</title>
                <link>http://juusan-kika.deviantart.com/journal/25088591/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/25088591/</guid>
                <pubDate>Tue, 02 Jun 2009 13:00:33 PDT</pubDate>
                
                <description><![CDATA[ You guys need to look up this movie called Dead Snow. I think it's norwegian but it's so awesome! It's not just about zombies, it's nazi zombies! *runs around like an idiot* <a href="http://www.deviantart.com/users/outgoing?http://www.deadsnow.com">[link]</a> other than the fact some bits look really funny the make-up on the zombies looks pretty amazing too! June 19th hooray, go Norway!<br /><br />Also check out my new work, fisherman's calm <a href="http://juusan-kika.deviantart.com/art/fisherman-s-calm-124461144">[link]</a> See, school ends and i finally bring new art. Which proves the educational system kills your creativity. (just another brick in the wall) And i've noticed while i do a little worse in school my works get a lot better. You guys think i should make a fanart on Dead Snow? Hmmmmm... <img src="http://e.deviantart.com/emoticons/s/smile.gif" width="15" height="15" alt="=)" title="=) (Smile)" /> it is fanart month. <br /><br />I take the SAT saturday. I mean i wanted to take it earlier in the summer cause i didn't want the problem i had with the ACT. "ACT is over! Go take your chemistry test, math test, and history exam in the following 2 days!" a week and a half to ready for the SAT. Nice. at least there aren't any distractions, like school. I can always retake it october, well wish me luck!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>geek rant</title>
                <link>http://juusan-kika.deviantart.com/journal/24624492/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/24624492/</guid>
                <pubDate>Wed, 06 May 2009 18:55:34 PDT</pubDate>
                
                <description><![CDATA[ Yeah so school's almost over and i think i can pull everything together. The only problem is i'm fallin behind on art! (OF ALL CLASSES) i usually finish before everyone what happened to a little thing called concentration? Sorry about lack of deviations. During the summer I'll be building a portfolio for Ringling, SCAD, and SVA well others to but these are the main (maybe even Vancouver)<br /><br /><br />I'd rather not do commercial rants but this is big... the geek rant...DEADPOOL (spoilers)<br /><br />Did you see wolverine? Great Wade Wilson. Horrible, horrible, horrible Deadpool. And deadpool is my favorite marvel so that really sucks. Deadpool is this guy <a href="http://www.deviantart.com/users/outgoing?http://www.marvel.com/comics/onsale/lib/view2.htm?filename=/i/content/st/24945new_storyimage7311162_full.jpg">[link]</a> (shut up it's funny!) not this guy (megaspoil) <a href="http://www.deviantart.com/users/outgoing?http://www.geektyrant.com/wp-content/uploads/2009/03/deadpool-3.png">[link]</a> ... what is that anyway?<br /><br />I love that movie, why? Becase 5 days after it came out... <a href="http://www.deviantart.com/users/outgoing?http://www.marvel.com/news/moviestories.7931.Deadpool_Movie_Confirmed~excl~_More_Wolverine~excl~">[link]</a><br /><br />omg<br /><br />Remeber DP was made in the 90's so no one thought he'd ever even be in movie now he's got his own! Cross your fingers that it is not messed up (i will watch it even if it is)<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>It's not over...</title>
                <link>http://juusan-kika.deviantart.com/journal/24380760/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/24380760/</guid>
                <pubDate>Wed, 22 Apr 2009 16:25:25 PDT</pubDate>
                
                <description><![CDATA[ ACT is done! I didn't do as well as a wanted. I really rushed reading and science. I'm actually horrofied that i plugged numbers wrong in my calculator. (There's no way of knowing now) Sad isn't it? Well on the bright side i get to relax! Tommorow i have a test in Chemistry and on Friday one on math isn't that the perfect way to spend the rest of ACT week! Tests in your hardest classes!<br /><br />i hate everything right now, why am i even taking chemistry?<br /><br />The contests look great, i don't think i'm gonna bother entering. Mix of low confidence with low free time.<br /><br />To put it this was, the only way to get my grades up and keep some up is to ace EVERYTHING that comes my way.<br /><br /><img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt="=D" title="=D (Big Grin)" /><br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>ACT! and other stuff</title>
                <link>http://juusan-kika.deviantart.com/journal/23993183/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/23993183/</guid>
                <pubDate>Tue, 31 Mar 2009 19:44:06 PDT</pubDate>
                
                <description><![CDATA[ More work comming along, i'm gonna recreate a few ideas i had during my headache a long while back. It'll be interesting.<br /><br />Oh my god! ACT! DEATH! I need to do well on the ACT test or else i HAVE to do well on the SAT.<br /><br />One of my favorite artists decided to host his gallery on dA a while ago. So i'm a little bit excited. IT'S SKOTTIE YOUNG! You guys are probably going "so what we see a few pros all the time" but this guy is really amazing so look at his stuff... right now! <a href="http://skottieyoung.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/k/skottieyoung.gif?1" alt=":iconskottieyoung:" title="skottieyoung"/></a> NOW!<br /><br />James Jean finished up 'Excavation' you should all look it up. Also look up "Julia Watkins Energism" cool stuff<br /><br />May movies: Wolverine (finally!), Up, Angels & Demons, Little Ashes, and Drag me to Hell (Raimi's back!)<br /><br />You guys may have already seen this ad on dA.. I'm gonna bring it up anyway. The bread art project. Uploading one pick donates $1 to feeding hunger here in the US. They're far from their goal right now. Whether you're an activist or not it takes less than a minute and it's not a waste of time. It doesn't need to be complicated, one of my favorites: <a href="http://www.deviantart.com/users/outgoing?http://breadartproject.com/?l=art&uid=S.650.18137.54310">[link]</a> just click "make art" in the corner from there and it's easy. You might see one of mine...<br /><br />ACTACTACTACTACTACTACTACTACTACT<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Computer Crash</title>
                <link>http://juusan-kika.deviantart.com/journal/23129072/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/23129072/</guid>
                <pubDate>Tue, 10 Feb 2009 20:09:00 PST</pubDate>
                
                <description><![CDATA[ Yeah, well a really bad virus made its way past the protection, raped my PC, and now my computer is dead.  So close to saving it to, it only takes a day people, remember that. It was a decade old fossil, but it was my fossil. Screw Webroot I never had this problem with Zone Alarms.<br /><br />And i know what you're thinking. Don't worry I backed up all my works just in time. And i will be dead for the remainder of the month. Due to starting over, having to download everything all over again (CS3 the Tablet) I had less than 2 months with my tablet...<br /><br />Don't worry <a href="http://ivorykeys0821.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/i/v/ivorykeys0821.jpg?1" width="50" height="50" alt=":iconivorykeys0821:" title="ivorykeys0821"/></a> your whale is saved, just not finished. I could try the school comps that have PS Elements, with a ...mouse. I did do ok works before while i had a mouse. It just took like 10 hours...<br /><br />So one big apology to everyone! I'll be active, just not uploading anything. My computer is dead.<br /><br /><br /><br /><br />OPTIMISM PLEASE PREVAIL!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Requests! - Watchers</title>
                <link>http://juusan-kika.deviantart.com/journal/22846933/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/22846933/</guid>
                <pubDate>Tue, 27 Jan 2009 15:58:36 PST</pubDate>
                
                <description><![CDATA[ Sorry, I'm usually not the one to spam messages or have more than 1 journal a month but there's good news concerning you!<br /><br />I reached 21 watchers! It was a small goal but it was my goal. Woo! Anyway, i'm taking requests now to celebrate. Requests on ANYTHING (except porn) You just ask and i'll work on it. It doesn't have to be serious, you can just give random ideas like "Hey you should do this" come on please do this i'm super happy right now!<br /><br />Other news... <br />I got into another feature, it's been awhile since that's happened to me Woo!<br /><br />James Jean updated his kindling section a long time ago you should still check them out <a href="http://www.jamesjean.com/">[link]</a> Toymaker is so bizzare i love it!<br /><br />Recession hits schools, funding for art might not come <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt="=(" title="=( (Sad)" /><br /><br />Colleges? SVA? SCAD? Ringling? Suggestions?<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Kindling</title>
                <link>http://juusan-kika.deviantart.com/journal/22504950/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/22504950/</guid>
                <pubDate>Sat, 10 Jan 2009 11:44:34 PST</pubDate>
                
                <description><![CDATA[ First off history is being made as the greatest artist in the world, James Jean, has just launched his solo exhibit in New York today <a href="http://www.processrecess.com/index.php?uid=B98B93">[link]</a>  Hope he'll update the Kindling section on his site. No, i'm not going all the way to NYC any time soon, but believe me i want to be there! Toymaker looks unbelievable. I want to see all of his stuff up close.<br /><br />Got these two new ideas, at least one off them I'll end up deciding that i like and actually work on, maybe both. Might take a week, cause i want it to look good, i'll still be attacking my neverending battle against backgrounds, as always tips are aprreciated.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Hmmm.</title>
                <link>http://juusan-kika.deviantart.com/journal/21937235/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/21937235/</guid>
                <pubDate>Thu, 11 Dec 2008 19:12:03 PST</pubDate>
                
                <description><![CDATA[ Yeah just forget whatever i write in these journals there's 2% chance that i actually stick to it. (I think too much) I didn't like the last portrait, i'm making another. I'm gonna keep working with digital though.<br /><br />HA! Got ya, remember 2% chance that any of these will happen. <br /><br />But winter break is coming so i WILL get something done. Whatever it might be. I haven't updated my journal in a while. I'd like to take this moment to tell anyone that comments on my work to be BRUTAL. Seriously guys be as anal as you can! How am I supposed to get better? Sheesh!<br /><br />Last year when Christmas came i really didn't want anything. Now I want a lot of stuff *greedy* *greedy* I'm gonna get a job after break. (I WANT STUFF!)<br /><br />(Originally the word "Yeah" was written 5 times in this entry. My teenager is showing)<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Appeals (concerning you!)</title>
                <link>http://juusan-kika.deviantart.com/journal/21249962/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/21249962/</guid>
                <pubDate>Fri, 31 Oct 2008 13:53:56 PDT</pubDate>
                
                <description><![CDATA[ I have been working on this GIANT portrait for a awhile now. Like over 10 hrs of work was put into it. Hopefully this will appeal to the guys that like my portraits because I'm going to take a little break and work on concept art, cartoons, and maybe a little science fantasy... (*hint* EM Centaur *hint*)<br /><br />I wanna work on some original stuff but I get the most faves on my portraits. Hopefully this one will be good enough to satisfy you guys when I take a break from portraits for a few months. Just for a little taste I'll give some details: 18"x24" 4b,6b, graphite powder, paperstump, natural model(no celebrity this time) It's BIG!<br /><br />The original stuff takes some drafting and planning but you will see it!<br /><br />btw... 3000 woot!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Comics</title>
                <link>http://juusan-kika.deviantart.com/journal/20958961/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/20958961/</guid>
                <pubDate>Sun, 12 Oct 2008 18:56:23 PDT</pubDate>
                
                <description><![CDATA[ <b>Smoke War</b><br />Smoke War is a comic about 3 soldiers who are taking part in a 500 year war between two city-states. But because the war has been going on for so long the people have forgotten their anger and reason so it hasn't been taken seriosly. There are no generals, captains, lieutenants, or even battles. Just people calling themselves soldiers for an excuse to fight eachother. But this changes...<br />I rate this: T (Action, Violence, and Crude Jokes)<br /><br /><b>The Greats</b><br />A childish comic about Drake(bat) and Dil(armadillo) and occasionally their friend, Amber, who get into all sort of wacky adventures. The exact opposite of Smoke War.Extremely cute, I'll try to make it funny. This will be in random strips instead of pages.<br />I rate this: A<br /><br />Give me critique and I'll take it. Give me suggestions and I'll thankfully take them. I'll try to put up previews by the end of the month.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Stuff</title>
                <link>http://juusan-kika.deviantart.com/journal/20763152/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/20763152/</guid>
                <pubDate>Tue, 30 Sep 2008 16:28:40 PDT</pubDate>
                
                <description><![CDATA[ Tommorow. I. Get. My. Copy. of... XOXO! <a href="http://www.processrecess.com/detail.php?uid=E3A8EC&start=0&limit=6">[link]</a> James Jean is the best, I can't wait to see what works are in it.<br /><br />I'm feeling like an amateur today. <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /> It's ironic how everywhere else people say you're a great artist and you're beaming until you climb on to dA or CA and see the REAL art and your ego gets crushed... I just feel like a nobody artist today. (Which I technically am: teenager with few skills)Hmmm... yeah, truth hurts. I'm considering using another art site along with dA any suggestions?<br /><br />Anyway, I got 2 portraits and a funny concept piece on the way, which is technically done but I want to finish the portraits before I load anything, i'm really close to finishing.<br /><br />Did you hear the Quantum Solace theme, nice, there's a reason why Jack White's a genius.<br /><br />In other news my first REAL relationship started then ended on the same day about 2 weeks ago so that's a kinda funny.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Sculptures?</title>
                <link>http://juusan-kika.deviantart.com/journal/20065140/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/20065140/</guid>
                <pubDate>Wed, 20 Aug 2008 17:58:00 PDT</pubDate>
                
                <description><![CDATA[ Most of my works are 2-D my favorite artist work in 2-D (or computer generated works) And I can honestly say that I suck working with clay. So I don't pay too much attention to sculpture... until now.<br /><br />Theo Jensen and Sachiko Kodamo will blow your mind. If you watch me and don't pay attention to my journals i probably don't care but you don't know what you're missing this time!<br /><br />Theo Jensen<br />Uses ONLY windpower to create the most amazing sculptures. I'm not talking a wind power sculpture you can put on your porch for passerbyes to see. This is crazy. His proudest works is the Strandbeests. I can't even explain check it out. <a href="http://www.youtube.com/watch?v=jUsCQoDCXoY">[link]</a> <a href="http://www.ted.com/index.php/talks/theo_jansen_creates_new_creatures.html">[link]</a><br /><br />Sachiko Kodamo<br />She makes liquid sculptures with a magnetic ferrofluid to create absolutely enchanting sculptures. This is not stop motion!<a href="http://www.youtube.com/watch?v=me5Zzm2TXh4">[link]</a><br /><br />Their websites:<br />TJ <a href="http://www.strandbeest.com/">[link]</a><br />SK <a href="http://www.kodama.hc.uec.ac.jp/index-e.html">[link]</a><br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>2,000!</title>
                <link>http://juusan-kika.deviantart.com/journal/18075291/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/18075291/</guid>
                <pubDate>Mon, 28 Apr 2008 17:50:08 PDT</pubDate>
                
                <description><![CDATA[ Wow! 2000 veiws! Thanks everyone, I suppose i should draw something new or at least take somethings that's not new but I never uploaded it for dA now seeing as I never get anywork done. <br /><br />Good News: We now have a scanner (that works)<br /><br />Bad News: Apparently dA isn't important enough to waste the scanner's time. So I'm still stuck with the same methods of camera or school scanner.<br /><br />Good News: Schools gonna end soon!<br /><br />Bad News: I can't concentrate on finals cause school is gonna end soon and if things get screwed over then summer will suck!<br /><br />Good News: Iron Man Hits Theatres on friday and there's no bad news about that!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>I've just realized something...</title>
                <link>http://juusan-kika.deviantart.com/journal/17916116/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/17916116/</guid>
                <pubDate>Fri, 18 Apr 2008 17:51:46 PDT</pubDate>
                
                <description><![CDATA[ I drew Ruben (my entry for the contest) scanned him then colored him with macromedia fireworks with a loose knowledge of the program. And I have to say it wasn't very stressfull. I could undo any mistakes and could get the basic coloring in minutes. Shading and lighting were handled by the dodge and burn tools. Now I'm far, far, far from a pro when it comes to CGArt but the whole thing taught me one thing... Traditional art rocks so hard because there isn't an undo button, because you have to cover every milimeter by hand, because your only tool for improvement is an eraser, and because it takes ten time longer to make it look as good as it would with CG. Now that is quality and hardcore dedication. <br /><br />I know CG art can be pretty tough if you work with something really hard and it can take forever. but the same thing will be harder if you try it with traditional. I still love CG but now I feel like faving 20 traditional works.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>And I'm missing out...</title>
                <link>http://juusan-kika.deviantart.com/journal/17611221/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/17611221/</guid>
                <pubDate>Mon, 31 Mar 2008 17:51:25 PDT</pubDate>
                
                <description><![CDATA[ (EDIT: I just remembered how annoying it is when ever I come back from something and I have a million things to check up on. I'll still be on dA to keep and eye on my watchees, just go around as much.)<br /><br />Crisis Core came out a while back for the PSP and I'm missing out just because I don't have a PSP. I have the money ($400 in savings so I've got more than enough) but my folks don't think it's responsible of me. Why can't they let me be irresponsible only for a little bit. So now I'm gonna get a job, and seeing as I'm 15 my opitons are probably McDonalds or someother crap food restaurant. (Jobs don't get better till 16) Oh wait, did I mention I live in the southern most inhabitable part of town where literally everything is a drive away. Great. <br /><br />Anyway, I think I'll stay off the internet for sometime because no matter where I go I see something that has to do with Crisis Core and it's a game that I really don't want spoiled. So I guess I won't be seen around.<br /><br />Now if you excuse me I need to find a Coin Star machine for my coin bank that weighs 4.5 lbs. With $34.64 worth of change. That's right I weighed and counted it, but my counting's probably off. Put together with my bills I'm halfway there!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>THIS MARCH</title>
                <link>http://juusan-kika.deviantart.com/journal/17274710/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/17274710/</guid>
                <pubDate>Mon, 10 Mar 2008 16:38:06 PDT</pubDate>
                
                <description><![CDATA[ I promise I'll upload it in march! If I don't I'll draw something new everyday in April! And I have some friends watching me so they can kick my ass if I don't keep the promise! <br /><br />Once again... Sorry! I'm working on it right now!<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>What's Up</title>
                <link>http://juusan-kika.deviantart.com/journal/15567436/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/15567436/</guid>
                <pubDate>Sun, 18 Nov 2007 18:50:33 PST</pubDate>
                
                <description><![CDATA[ What's going on right now...<br />
<br />
Well within dA i actually have 2 pics ready to upload but because i don't have access to my own computer (This is someone else's computer) that won't be happening unless i can get it during thanksgiving break (in a few days.) And i actually think one of the pics is really good.<br />
<br />
My favorite series is apparently gonna get canceled soon. I fell behind on the issues and apparently the very next issue anounced that they'd eventually cancel it. Awww... No fair. I should get a tattoo and rebel against it! Or maybe i shouldn't...<br />
<br />
I just had a vision about my favorite game, Kingdom Hearts. Or a dream but i prefer term 'vision' and it ROCKED! I feel like ranting about it but i'm holding my self back.<br />
<br />
Wait a second... 1000 VEIWS? WHEN DID THIS HAPPEN? I've been really slow on dA lately, in a month i probably got only one new fave and two comments. How did this happen? Does dA have a glitch? Or maybe my friends are just checking up on me...<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>bad mood.</title>
                <link>http://juusan-kika.deviantart.com/journal/14184327/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/14184327/</guid>
                <pubDate>Wed, 15 Aug 2007 17:36:55 PDT</pubDate>
                
                <description><![CDATA[ Sorry I've been in a bad mood lately.(warning: this is a complaint you don't have to read)  My dad's in Germany right now so my mom and older sister argue constantly about college meaning I babysit my little sister 24/7 Try to imagine a little girl... six years old... bubbling with energy. She's the girl that whines, pulls on your shirt, and has tantrums when she's cranky from sleep. Do you know how hard it is to get her to bed? Let's just say she falls asleep and 10 pm like i do. Usually this is bearable but 24/7? I took care of everything. Not to mention my older sister has to bitch about everything. EVERYTHING. Once my little sister is finally asleep and my older sister is done calling me a stupid idiot cause I wore a hole through my socks... i decide to go downstairs because now I can't sleep. I turn on the TV and for one second i think, 'Green Mile is on? I love this movie, it's my lucky day!' But my older sister must have supersonic hearing because she comes down in her pajamas and channel flips bitching about how Green Mile sucks. In a bad mood I quietly tell her to change it back. 'Too bad' after that reply from her i walked upstairs queitly to my room without a word and shoved everything off my desk and started cursing into the pillow!  I fell asleep and 3am and i went to orientation the next day(today.) And what do you know... they still didn't give me a list of school supplies. School starts tuesday. <br />
<br />
No, i'm not furious cause i didn't get to see the Green Mile just cause she deliberatly tortures me. My older sister loves insulting people. There i said it. She can't go one hour without calling someone stupid. In her dreams i think she calls people idiots. Oh and if you're and adult reading this by chance and you would like to say something like, "That's life wait till you're an adult and you have to take care of your own children. This just proves you aren't ready" then you should GTFO! If you're an adult that won't say that then I thankyou for not saying it.<br />
<br />
btw: I'm not gonna be on dA for a week. Hopefully then AkuRoku Week will be over and i'll be allowed to look at some deviations. AkuRoku pisses me off even more...I'll kindly murder whoever started this holiday.(no, that's not an oxymoron.)<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>Heh...heh...Sorry!</title>
                <link>http://juusan-kika.deviantart.com/journal/13699947/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/13699947/</guid>
                <pubDate>Wed, 11 Jul 2007 19:41:42 PDT</pubDate>
                
                <description><![CDATA[ I'm sorry, the art dump wasn't much of an art dump. I only got four works and only two were related to warped tour. I was thinking to give myself time to post a lot but whenever i finished a deviation I got really eager to post it, so waiting two days is big for me. two works a day is a lot for me. It only takes a little over an hour to draw the really good ones but my brain doesn't work so fast on coming up with ideas as my hands on drawing.<br />
<br />
I'm still sorry!<br />
<br />
Tommorow is my birthday so all the work i post after this will be in a whole new age group! (kinda...) I'm still excited for the fact that it's my birthday tommorow! <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt="=D" title="=D (Big Grin)" /><br />
<br />
Go look at my 4 new deviations! ...please?<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
          <item>
                <title>*humming*</title>
                <link>http://juusan-kika.deviantart.com/journal/13662726/</link>
                <guid isPermaLink="true">http://juusan-kika.deviantart.com/journal/13662726/</guid>
                <pubDate>Sun, 08 Jul 2007 19:35:04 PDT</pubDate>
                
                <description><![CDATA[ At warped tour a bunch of unrecognized bands sold CDs real cheap. They're. Stuck. In. My. Head. Whenever a get a song stuck in my head it doesn't come out for days. I've got quite a few CDs and i've only listened to one. This could be hell for me.<br />
<br />
Anyway...I really need to fill up my gallery, and luckily I took a lot of photos at warp tour. (No, i'm not going to post the photos i'm going to draw off of them) I'll see if i can make it into an art dump (Slim chances of art dump) I'll also make a I.D. It'll be a comic of some sort.<br />
<br />
Wow, i don't write a lot of journals... I should fix that.<br /><br /> ]]></description>
                <author>~juusan-kika</author>
            </item>
    </channel>
</rss>