<?xml version="1.0" encoding="utf-8"?>

<rss version="2.0" xmlns:media="http://search.yahoo.com/mrss/" xmlns:atom="http://www.w3.org/2005/Atom" xmlns:creativeCommons="http://backend.userland.com/creativeCommonsRssModule">
    <channel>
        <title>deviantART: by:manafimaster</title>
        <link>http://search.deviantart.com/?q=by:manafimaster&amp;section=today</link>
        <description>deviantART RSS for by:manafimaster</description>
        <language>en-us</language>
        <copyright>Copyright 2009, deviantART.com</copyright>

        <pubDate>Fri, 18 Dec 2009 18:00:27 PST</pubDate>        
        <generator>deviantART.com</generator>
        <docs>http://blogs.law.harvard.edu/tech/rss</docs>
        <atom:icon>http://s.deviantart.com/minish/widgets/apple-touch-icon-precomposed.png</atom:icon>
        <atom:link href="http://backend.deviantart.com/rss.xml?q=by%3Amanafimaster&amp;type=journal" rel="self" type="application/rss+xml" />
                  <item>
                <title>ughhhh</title>
                <link>http://manafimaster.deviantart.com/journal/18052328/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/18052328/</guid>
                <pubDate>Sun, 27 Apr 2008 10:12:47 PDT</pubDate>
                
                <description><![CDATA[ I'm kinda thinking about making a new account. cuz' #1, I'm watching too many people & usually my friends' deviations usually get "bumped off" the watch list, & such. #2, it might get me to be a little more active & not procrastinate on getting here to view my messages. Maybe one account for my anime stuffs, & another for realism & photography, if I ever post it. <br />      I particularly enjoy this user name (despite that it has a pokemon name in it & "master", which looks kinda like I'm a pokemon fantard--I used to be but I haven't the time for it anymore <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /> ), so I'm not too sure whether to just clear everyone that I watched & rewatch my close friends & clear this & that n' such, or just get a new account to make this a WHOLE LOT easier.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>TAGGED</title>
                <link>http://manafimaster.deviantart.com/journal/17563061/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/17563061/</guid>
                <pubDate>Fri, 28 Mar 2008 19:18:36 PDT</pubDate>
                
                <description><![CDATA[ tagged by <a href="http://koolkatt.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/o/koolkatt.gif" width="50" height="50" alt=":iconkoolkatt:" title="koolkatt"/></a><br /><br />~1. Post these rules.<br />~2. Each tagged person must post 8 things about their self on their journal.<br />~3. At the end, you have to choose and tag 8 people and post their icons on the same journal.<br />~4. Go to their pages and send a message saying you tagged them.<br />~5. No tag-backs.<br /><br />_____________________________________________<br /><br /><br /><br />1.<br />I have had Bell's Palsy when I was four; it was treated, obviously, then I received it again when I was 9. That was like 5 years separate, so I'm getting worried if its gonna reoccur. <br /><br />2.<br />My favorite comedian might be Jim Gaffigan<br /><br />3.<br />I'll be quitting boxing & starting Karate, so I can receive the proper discipline for schoolwork ( I was dumb enough to procrastinate on the music report; its due in a couple of days)<br /><br />4.<br />I'm getting pretty inactive in most all the websites I've gone so far, including here, oekakis, & a couple of other places.<br /><br />5.<br />I'm hoping to get an Angora one day.<br /><br />6.<br />In irl, its getting harder & harder for me to maintain friends. :c<br /><br />7.<br />I wish to have a high-paying job (really high paying), so I'm not going to an art college as I wished as a child. I'll be hoping to get a Phd in surgery, & probably gain a couple more friends here & there, so I can at least chat once in a while<br /><br />8.<br />My dog refuses to eat dog food D: of any kind.<br /><br />Now tag 8 of your friends!<br /><br />I don't feel like it TTATT<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>SPRING BREAK</title>
                <link>http://manafimaster.deviantart.com/journal/17513519/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/17513519/</guid>
                <pubDate>Tue, 25 Mar 2008 17:09:13 PDT</pubDate>
                
                <description><![CDATA[ ...although this update is a little late; hence the beginning of the break was last friday. :c um, the break ends this week; I haven't begun the music report i was supposed to do about the woodwind instrument (although i believe its fairly easy). <br />i dunno.<br />I might go to a Chicano museum this week, along with a bit of Swap Meet (that might be fun <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /> ) & maybe a day in Universal Studios (its this really cool theme park where they make the movies & all if you guys don't know yet). Its quite a bit of places we're going to. cause I usually stay home almost all the time; my parents don't appreciate me going to 94375984375347859347594385r places a week like most teenagers do. I'm alright with that, you need at least one or two friends who are willing to go, right?<br /><br />I'll be posting new deviations soon this week. Its obvious that I haven't done anything much.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/17351123/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/17351123/</guid>
                <pubDate>Sat, 15 Mar 2008 17:24:05 PDT</pubDate>
                
                <description><![CDATA[ i wont be on in the weekdays, just so you guys know. <br />& I WATCHED HORTON HEARS A WHO c:<br />It was AWESOMEEE. I especially like the Mayor's son o3o & unless I have a crap-ass sense of humor, I think it was funnyyy<br />my favorite character is um. I forgot the name but she keeps unfocusing her eyes in a  weird way & floats with her mouth open. i dunno. hard to describe.<br /><br />NARUTO<br />[x] You're stubborn.<br />[x] You like ramen.<br />[ ] Are foxes your favorite animal?<br />[x] You're afraid of ghosts.<br />[x] You're jealous of your best friend.<br />[] Are you a hands-on kind of person?<br />[] Do you have a crush on someone, who isn't interested in you?<br />[] You want people to respect you.<br />[x] You never give up.<br />[ ] Are you tan?<br />[ ] Were you born on the 10th of October?<br /><br />Total: 5<br /><br />SASUKE<br />[x] You don't care about other people or their opinions.<br />[ ] Are you left handed?<br />[x] You prefer being alone.<br />[x] Are you cold, cruel or withdrawn? (irl yes)<br />[x] Are you talented?<br />[x] Have you had to work on your social skills?<br />[x] Do you practice your skills?<br />[x] Do you have a motive in your life that you live for?<br />[ ] Do you feel like you're cursed?<br />[ ] Were you born on the 23rd of July?<br /><br />Total: 7<br /><br />SAKURA<br />[ ] You like the color pink.<br />[ ] Do you feel like something inside of you is ordering you?<br />[ ] You and your friends have a crush on the same person.<br />[x] You're smart.<br />[ ] You have a five-finger forehead.<br />[x] You usually repress your emotions.<br />[x] You insult people just to annoy them.<br />[x] You're aiming for a medical career.<br />[ ] You grew long hair because of your crush.<br />[ ] Were you born on the 28th of March?<br /><br />Total: 4<br /><br />KAKASHI<br />[ ] You read romance novels.<br />[x] You like to spend time in the fields.<br />[x] Have you separated from some group?<br />[] Is your personality hard to describe?<br />[ ] Are you often late?<br />[x] Do you like to use something that covers your mouth?<br />[ ] Do you use the sayings: "A black cat crossed my path..." or "I fell into a sewer..."?<br />[ ] Is one of your eyes a different color from your other one?<br />[ ] You only have one hobby.<br />[ ] Were you born on the 15th of September?<br /><br />Total: 3<br /><br />ITACHI<br />[x] You like red and black.<br />[ ] You wear purple nail polish.<br />[ ] You paint your toenails.<br />[] You've been the leader in a group.<br />[ ] You're a lot more advanced than other in your age class.<br />[x] You're unforgiving at times.<br />[x] You judge people.<br />[x] You hang out with a certain crowd.<br />[x] You have a little brother.<br />[ ] You dress in overly long clothes. <br /><br />Total: 5<br /><br />GAARA<br />[] You like sand.<br />[x] You could care less.<br />[ ] You feel like no one loves you.<br />[x] You're alone a lot of the time.<br />[ ] You've made some sort of a symbol of love on your skin.<br />[ ] Your name means death in Japanese.<br />[ ] You have one reason to live.<br />[x] Your life has had a significant turn.<br />[] You have red hair.<br />[ ] Is you birthday on the 19th of January?<br /><br />Total: 3<br /><br />LEE<br />[x] You believe in hard work.<br />[ ] You're decisive.<br />[ ] You have large eyes.<br />[x] You're a unique person.<br />[x] You've seriously decided to do something.<br />[x] You have a huge crush on someone. [Not at the moment. |D;]<br />[] You have a person who you share a warm relationship with.<br />[ ] You have a black bowl-cut.<br />[ ] You've been in an accident where you were had little chance to survive.<br />[x] You like green.<br /><br />Total: 5<br /><br />JIRAIYA<br />[ ] You write and sell romance novels.<br />[] Are you a pervert? <br />[ ] Do you like alcohol?<br />[] You're somewhat famous.<br />[ ] You have long/white hair.<br />[ ] Do you spy on people for some reason?<br />[x] You're specialized in some field. (health lol)<br />[ ] You're over 20.<br />[ ] You're in some way great.<br />[ ] Do you have an ambiguous way of thinking?<br /><br />Total: 1<br /><br />OROCHIMARU<br />[x] Are you pale?<br />[x] Do you like snakes?<br />[ ] Is one of your hobbies fencing?<br />[x] Are you strong?<br />[ ] Are you sadistic, power-hungry and egoistic by nature?<br />[ ] Do you use people as pawns?<br />[x] Do you have a dream?<br />[ ] You don't feel empathy for other people.<br />[ ] Do you lust for someone else's body?<br />[ ] Are you over 20?<br /><br />Total: 4<br /><br />TSUNADE<br />[ ] Do you like to play gambling games?<br />[x] Do you like snails?<br />[] Do you have a pig/pigs at home?<br />[ ] Are you afraid of blood?<br />[ ] Do you have an object that you believe brings back luck?<br />[x] You're in the medical field. (lol)<br />[ ] You're dependent on something.<br />[ ] You're a blonde.<br />[x] Do you use rejuvenation creams?<br />[ ] Are you over 20?<br /><br />Total:... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>damn it.</title>
                <link>http://manafimaster.deviantart.com/journal/17125681/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/17125681/</guid>
                <pubDate>Fri, 29 Feb 2008 22:45:04 PST</pubDate>
                
                <description><![CDATA[ Contest. It doesn't really pay any good drawings so its your choice to join. Ends at March 23th, blahblahblah. <br /><br />Just draw a new style for my persona. This is how it is now; I like it, but I'm tired of drawing the FRONT PART over & over & over again.<br /><a href="http://op.weazie.com/vulpix/pictures/359.png">[link]</a><br />Just...draw a new hair style for my persona. Front part only; keep the orange strip in there xD. Takes 5 seconds to do; why not?<br /><br />Prizes:<br />1.) A 3-month subscription for the people with no sub. The ones with subs, you'll get a drawing; along with...thenonsubs. xD; They'll get something too c:<br />The drawing will be watercolor. probably.<br /><br />2.) 3 solid drawings<br /><br />3.) 1 solid drawing & a lineart request<br /><br />That's pretty much it. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br /><br />RULES:<br />1) Answer the questions below<br />2) Take each answer and type it into dA search box<br />3) Take a deviation from the first page of results (may use ' popular' or 'newest' ) and post thumb (for subscribers) or link (non-subscribers)<br />4) You can't copy the persons answers who posted this before you<br />5) then tag 5-10 people<br /><br />1. What's your favorite anime?<br /><br /><a href="http://mebidtt13.deviantart.com/art/Higurashi-no-Naku-Koro-ni-64553669">[link]</a><br /><br />2. what was the first anime you got into?<br /><br /><a href="http://e-drian.deviantart.com/art/Megaman-44468447">[link]</a><br /><br />3. Who's your favorite anime character?<br /><br /><a href="http://kairioflight.deviantart.com/art/Higurashi-ID-Sonozaki-Mion-75073761">[link]</a><br /><br />4. whats your newest anime obsession?<br /><br />-points to above statements-<br /><br />5. Whats your favorite anime pairing?<br /><br /><a href="http://seisei.deviantart.com/art/Bleach-Ishida-Orihime-Squish-16320975">[link]</a><br /><br />6. whats your favorite pokemon?<br /><br /><a href="http://bathsraikou.deviantart.com/art/Kyogre-18395455">[link]</a><br /><br />7. Whats your favorite manga?<br /><br />well its called life but I cant find it here TTATT<br /><br />8. Whats your favorite song from an anime?<br /><br /><a href="http://vatenkeist.deviantart.com/art/keep-my-pace-bleach-29614615">[link]</a><br /><br />9. which anime character do you feel you relate to most (in apperance)?<br /><br />-cantfindanythingdecent-<br /><br />10. which anime character do you feel you relate to most (in personality)?<br /><br /><a href="http://messa.deviantart.com/art/Inoue-Orihime-53804851">[link]</a><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>lol</title>
                <link>http://manafimaster.deviantart.com/journal/17031244/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/17031244/</guid>
                <pubDate>Sat, 23 Feb 2008 19:34:07 PST</pubDate>
                
                <description><![CDATA[ Sorry for not being on for a few weeks; I'm sure you guys have noticed, hence I haven't been commenting on the usual peoples' works as I usually have. Be assured; I will come back the next day & try to be active. Its just that my brain...got accustomed to ignoring this place after my few-month break, lol |D;<br /><br />I'll check my messages tomorrow also; some comments may not be replied due to the "bumping off" of message alerts, as pictures get bumped off oekakis for newer pictures--messages in this case. I just studied a little too much, its actually fun to me & my friends keep calling me a nerd/geek for that o_o BUTTTT My grades HAVE gone a lot higher (lots of A's & one B+ in P.E. -__-; )<br /><br />I'll study & read a bit more today & leave it off for tomorrow.<br /><br />Mmkay? <br />mmkay <img src="http://e.deviantart.com/emoticons/h/heart.gif" width="15" height="13" alt=":heart:" title="Heart" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>BAWW</title>
                <link>http://manafimaster.deviantart.com/journal/16707159/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16707159/</guid>
                <pubDate>Sun, 03 Feb 2008 12:52:15 PST</pubDate>
                
                <description><![CDATA[ All of these are real life. wtfever.<br /><br /><br /><br /><br />1. Cynthia<br />2. Sophia<br />3. Leslie Ha<br />4. Crystal<br />5. Sarah<br /><br />DON'T LOOK AHEAD UNLESS YOU FILLED UP THE TOP!<br />1. How did you meet 3? Third grade; "talented class"<br /><br />2. What would you do if #2 and #3 were going out? ...<br />That's just messed<br /><br />3. How long have you known #4? Since Kindergarten; she hated me at first, but we became friends soon after C:<br /><br />4. What do u think of #2? Confident, fun, VERYSMART, talented in everything, happy-go-lucky<br /><br />5. A fact about #4? We're not as much of friends we used to be :c<br /><br />6. Who is #2 going out with? She wants to go out with this kid named Michael; her choice if she wants to or not T_T<br /><br />7. What's #1 do for a living? Sleep.<br /><br />8. Where does #5 live? A block away from me <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br /><br />9. Is #1 your best friend? Sorta.<br /><br />10. Do you miss #2? nope<br /><br />11. What would you do if #3 and #4 were going out? Freaky.<br /><br />12. Ever gone somewhere with #5? no.<br /><br />13. What would you do if #1 and #5 were going out? Don't care xD<br /><br />14. What do you think of #3? She probably changed since I last saw her; I still love her though :<<br /><br />15. Ever slept over in the same house with #5? no<br /><br />16. Ever been to #2 house? Yep. She has her own home-theater. u_u<br /><br />17. What would u do if #4 was in jail? I'd go bail her out C:<br /><br />18. Do you care about #3? More than all my other friends ;n;<br /><br />19. What is the one thing you love about #1? Her personality (:<br /><br />20. Would you ever party with any of I dunno <img src="http://e.deviantart.com/emoticons/c/confused.gif" width="15" height="30" alt=":?" title=":? (Confused)" /><br /><br />21. Ever see #4 naked? um.. no.<br /><br />22. Do #1 and #2 know THEY'RE BEST FRIENDS, DKFJJFDSFDS.<br /><br />23. Are you related to any of the 5? Everyone in the world is related to eachother in at least one way: being human <img src="http://e.deviantart.com/emoticons/w/wink.gif" width="15" height="15" alt=";)" title=";) (Wink)" /><br /><br />24. Have you kissed any of the 5? uh.. no.<br /><br />25. Ever do something illegal with any of the 5? hm.. i dont recall.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>...</title>
                <link>http://manafimaster.deviantart.com/journal/16512389/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16512389/</guid>
                <pubDate>Mon, 21 Jan 2008 20:00:49 PST</pubDate>
                
                <description><![CDATA[ Stolen from *<a class="u" href="http://wispu.deviantart.com/">Wispu</a><br />
<br />
ANOREXIA<br />
<br />
[] you have dry skin.<br />
[] you eat 1 meal.<br />
[ ] you're very weak.<br />
[x] you hate your body.<br />
[ ] you starve yourself.<br />
[x] you have low self esteem.<br />
[ ] you use laxatives.<br />
[x] you need to be more skinny. (overweight by like 5 pounds D: )<br />
[] people always say you're skinny, but you think fat.<br />
[ ] people think you are too skinny.<br />
total: 3<br />
<br />
ADHD (ATTENTION DEFICIT/HYPERACTIVITY DISORDER)<br />
<br />
[x] your mind is all over the place.<br />
[x] you are hyper most of the time.<br />
[x ] you barely pay attention to anything.<br />
[ x] you cannot cooperate with people well.<br />
[ ] you seem to never sit still.<br />
[] you talk all the time.<br />
[ ] you need attention 24/7.<br />
total: 4<br />
<br />
BIPOLAR DISORDER<br />
<br />
[x] you can act wild at times then the next day you are depressed.<br />
[x] you are very irritable.<br />
[ ] you barely get any or no sleep.<br />
[X] you are anti-social.<br />
[] you have very high self esteem at times.<br />
[ ] you are abusing alcohol, drugs, or sex.<br />
[x] you have thought of/attempted suicide.<br />
total: 3<br />
<br />
BULIMA NERVOSA<br />
<br />
[ ] you throw up all of your food.<br />
[ ] you throw it up even when you don't feel sick.<br />
[ ] you have no control over how you eat.<br />
[ ] you use laxatives.<br />
[x] you have overly exercised to where you almost fainted/passed out.<br />
[ ] you always say you are fat, when you aren't.<br />
[ ] people think you are way too skinny.<br />
total: 1<br />
<br />
CONDUCT DISORDER<br />
<br />
[x] you are a bully.<br />
[x] you threaten other people.<br />
[x] you often find yourself in fights.<br />
[ ] you have used a weapon that could cause injury to others. (ex: knife, bat, etc.)<br />
[ ] you are cruel to humans and/or animals.<br />
[ ] you have raped/molested someone.<br />
[ ] you destroy property on purpose<br />
[x]you always lie. (irl only )<br />
[ ] you stay out all night.<br />
[ ] you have ran away from home.<br />
total: 4<br />
<br />
DEPRESSION<br />
<br />
[ ] you are always sad.<br />
[] you find no hope in your future.<br />
[x ] you find no longer excitement over the activities you used to love.<br />
[x ] you always find yourself around the house or in bed all day.<br />
[ X] you can be/are anti-social.<br />
[X] you have low self esteem.<br />
[x ] everything bad that happens is always your fault.<br />
[ ] you always seem to be weak or have physical features hurt.<br />
[] you are failing school. (struggling hard not to do that T_T )<br />
[x ] you have thought of/attempted suicide.<br />
[ ] you have ran away from home.<br />
[ ] hope is no longer there for you.<br />
total: 6<br />
<br />
OCD (OBSESSIVE COMPULSIVE DISORDER)<br />
<br />
[x] you have daily rituals.<br />
[x] you have disturbing thoughts or thoughts you hate.<br />
[x ] you have to do a certain thing until it feels right.<br />
[x] you have to keep things in a certain order.<br />
[x ] you have harmed yourself.<br />
[ x] you are afraid you will get a std, aids, or any kind of germs.<br />
[x] you have to check some stuff over again. (ex: checking the door repeatly)<br />
total: all u_u<br />
<br />
PTSD (POST-TRAUMATIC STRESS DISORDER)<br />
<br />
[x ] you repeatly have flashbacks of horrible moments/memories in your life.<br />
[x ] you repeatly have dreams of horrible moments/memories in your life.<br />
[ x] you sometimes think the event will happen again.<br />
[ ] you feel highly uncomfortable when remembered/remembering the event.<br />
[X ] you can be/are anti-social.<br />
[x ] you have lost interest in the things you used to love.<br />
[] you have not had alot of sleep lately.<br />
[x] you worry about dying at a early age or dying at all.<br />
[x] you can have angry outbursts.<br />
[x ] you act younger than your age. (ex: thumbsucking, etc.)<br />
total: 8<br />
<br />
SCHIZOPHRENIA<br />
<br />
[x] you often have hallucinations (seeing things or hearing things that aren't there). (I dunno ;_; I hear stuff, but my house is haunted, but people say it isn't & ... )<br />
[x] you have strange, unusual dreams or thoughts.<br />
[ x] you can be confused about reality and fantasy.<br />
[x ] you think people are always staring or talking about you.<br />
[ x] you have extreme anxiety or fearfullness.<br />
[x ] you have difficulty with relationships with family, friends, and opposite sex.<br />
[ ] you do not take care of your hygeine like you should.<br />
[ x] you are very shy.<br />
[ x] you often talk to yourself.<br />
total: 8<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>:D</title>
                <link>http://manafimaster.deviantart.com/journal/16482122/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16482122/</guid>
                <pubDate>Sat, 19 Jan 2008 22:15:00 PST</pubDate>
                
                <description><![CDATA[ Stolen from *<a class="u" href="http://katgirl123.deviantart.com/">Katgirl123</a>, as usual. <img src="http://e.deviantart.com/emoticons/s/smile.gif" width="15" height="15" alt=":)" title=":) (Smile)" /><br />
<br />
Imma do this out of boredom, so there's no need to comment n_n<br />
<br />
Time Started---9:55 P.M.<br />
<br />
Name: Sandra<br />
Gender: F<br />
<br />
8) How old do you look?<br />
16 o_o<br />
<br />
<br />
9) How old do you act ?<br />
3<br />
<br />
10) What's the last song you heard/sang?<br />
Always by Saliva<br />
<br />
11) Have you recently become a member of anything?<br />
lotsa stuff. Don't bother to ask.<br />
<br />
12) What are your plans for the weekend?<br />
Go to the mountains & see snow for the first time<br />
Paint a ridiculous picture of my friend's sister<br />
Go watch Cloverfield<br />
Study the arts.<br />
<br />
13) What is your mood at the moment?<br />
calm.<br />
<br />
<br />
14.) Have you ever ridden a mechanical bull?<br />
lol<br />
the little 25-cent ones or some robot thing?<br />
<br />
<br />
15) Do you ever intentionally vomit after drinking?<br />
wine. |D<br />
Yep.<br />
<br />
16) If you were working on a pirate ship, what would you most likely be?<br />
The hell am I supposed to know.<br />
<br />
17) Have you ever called anyone a ----?<br />
someone did to me many times, but never would I do that o_o<br />
<br />
18) Has anyone ever called you a ----?<br />
many times u_u<br />
<br />
<br />
19) Have you ever smuggled something into Canada?<br />
Never would I do that ):<br />
<br />
<br />
20) Does playing a guitar make someone more attractive?<br />
WTFNO.<br />
<br />
21) Do you live in a city with a good sports team?<br />
Anaheim Angels, but they turned into the friggin' Los Angeles Angels of Anaheim & crap. & then we have those Anaheim Ducks or something, that hockey team :/<br />
<br />
22) Have you ever finished off the popcorn?<br />
yeah |D<br />
<br />
<br />
23) Have you ever turned someone down for a date?<br />
No one's asked.<br />
<br />
24) What's your favorite super-hero?<br />
I dunno. Mother Teresa?<br />
<br />
25) Do you have more enemies or more friends?<br />
more enemies.<br />
<br />
<br />
26) Have you ever sent an anonymous letter?<br />
yeah XD<br />
<br />
27) Can you fix your own car?<br />
nope<br />
<br />
<br />
28) Are you smarter than your friends?<br />
in the middle<br />
<br />
30) Have you ever stolen anything from your friends?<br />
usually, but for fun xD;<br />
<br />
<br />
31) Have you ever been to jail?<br />
I plan not to <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
<br />
32) Last thing you bought over 50 dollars?<br />
Art canvas.<br />
<br />
33) Do you like the smell of beer?<br />
hellno.<br />
<br />
<br />
34) Have you ever died or killed someone in a dream?<br />
The cats. They killed.<br />
<br />
35) Have you ever given to charity?<br />
They need it, so naturally, yep.<br />
<br />
36) Would you kill a dog for $1,000?<br />
That's against my friggin' beliefs XD<br />
<br />
38) Do you live with your parents?<br />
yeah<br />
<br />
39) Do you have plans for your future?<br />
Its a veryyyyyyyyy complex plan, one that will earn me a lot of money.<br />
a lot.<br />
<br />
Unless that dream gets broken, then I would have a problem...<br />
<br />
<br />
YOU ARE...<br />
[] under 5'4<br />
[] 5'4"-5'5"<br />
[] 5'5"-5.6"<br />
[x] 5'6.5 - 5'7 ''<br />
[] 5'7" - 6'0<br />
[] tall (6.1 and up)<br />
<br />
<br />
<br />
NATURALLY<br />
[] blonde<br />
[] redhead<br />
[ brunette<br />
[] dirty blonde<br />
[] brownish<br />
[x] dark brown<br />
[] black<br />
[] red/light brown sorta strawberry blonde<br />
[] don't Know, dyed Too Much<br />
<br />
[] blue-eyed<br />
[x] brown-eyed<br />
[] black-eyed<br />
[x] green-eyed (its in my genes, but I don't have them)<br />
[] hazel-eyed<br />
[] gold/gray-eyed<br />
[] silver/gray- eyed<br />
[] blue/green/brown-eyed<br />
[] blue/gray-eyed<br />
[] green/gray-eyed<br />
[] they change colors<br />
[] amber<br />
<br />
[] glasses<br />
[] contacts<br />
[x] neither<br />
[] both<br />
<br />
[] medium hair<br />
[x] long hair<br />
[] short hair<br />
<br />
<br />
Your favorite color(s) are?<br />
[x red<br />
[] khaki<br />
[x] aqua<br />
[] pink<br />
[ hot pink<br />
[] yellow<br />
[] black<br />
[] emerald green<br />
[] lime green<br />
[] blue<br />
[] navy<br />
[x] white<br />
[] turquoise<br />
[] silver<br />
[ purple<br />
[] brown<br />
[x] orange<br />
[] grey<br />
[] fuscia<br />
[x] maroon<br />
[] gold<br />
[x] teal<br />
[] coral<br />
[x] clear<br />
[] bronze<br />
[] I don't really care<br />
[] rainbow<br />
[] I basically like all colors<br />
<br />
<br />
<br />
YOUR PERSONALITY IS SOMETIMES...<br />
[X] talkative<br />
[X] shy<br />
[] funny<br />
[x] serious<br />
[x] laid back<br />
[x] strict<br />
[] hyper<br />
[] sarcas... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>yessss</title>
                <link>http://manafimaster.deviantart.com/journal/16239482/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16239482/</guid>
                <pubDate>Thu, 03 Jan 2008 12:21:00 PST</pubDate>
                
                <description><![CDATA[ Today. Is my birthday.<br />
I. am 13 dammit <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /> <br />
<br />
& I steel dis from <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
1. What is your character's name?<br />
Kire'<br />
<br />
2. What is your character's name in another language?<br />
The hell am I supposed to know.<br />
<br />
3. How old is he/she?<br />
My age (1-3-95)<br />
<br />
4. What is your character's race/species?<br />
Korean<br />
<br />
5. Do they have a crush?<br />
She has a grudge with teh guys D:<br />
<br />
6. Do they have many friends?<br />
Oblivion, Mocha, Kim, Keratin, misha.<br />
some only know one; I haven't given most of them a proper reference<br />
<br />
7. What planet is your character from?<br />
Earth, obviously<br />
<br />
8. Does your character like to eat?<br />
Only on Holidays will she stuff herself to her limit.<br />
<br />
9. What's his/her favorite food?<br />
Pomegranate<br />
<br />
10. What's his/her favorite drink?<br />
Apple Juice<br />
<br />
11. Is your character annoying?<br />
yep<br />
<br />
12. Is your character loved?<br />
yep, just like anyone else<br />
<br />
13.Is your character hated?<br />
she lies in the weird group. She be hated by non-weirdos (:<br />
<br />
14. Is she/he emo/goth?<br />
not really, but there are moments o_o<br />
<br />
15.Is she/he straight, bisexual, or gay?<br />
She be bi<br />
<br />
16. Is she/he a virgin?<br />
she be virgin<br />
<br />
17.Name 3 hobbies...<br />
Drawing, studyinglol, more studying.<br />
<br />
18.Is your character normal?<br />
Depends. Looks or personality?<br />
<br />
19.Is your character attractive?<br />
Average<br />
<br />
20.How does your character handle emotions?<br />
immaturely.<br />
<br />
21.Does your character have other forms?<br />
nope<br />
<br />
22.Does your character overreact?<br />
always.<br />
<br />
23.Is your character a criminal?<br />
sorta.<br />
<br />
24.Does your character go to school?<br />
Yup.<br />
<br />
25.What's his/her IQ?<br />
97<br />
<br />
26.Does your character have a disease/curse?<br />
nope.<br />
<br />
27.Is your character dead?<br />
nope<br />
<br />
28.Does your character have a family?<br />
Mary-sue stuff happened. xD I might fix that later<br />
<br />
29.Has he/she encountered any tragic times in life?<br />
not really<br />
<br />
30.What's the best time in your character's life?<br />
Drunkness, before the hangover. o_o<br />
<br />
31.If you could name 1 friend, which would you relate to your character?<br />
I'm not gonna hurt anyone ):<<br />
<br />
32.Is your character single?<br />
She's proud (:<br />
<br />
33.Has he/she developed any relationships?<br />
no<br />
<br />
34.Does he/she have an element?<br />
what the hell?<br />
<br />
35.Do you role-play your character?<br />
Sometimes. Not very much, though. I haven't RP'd in many months.<br />
<br />
36.Do you write about your character?<br />
Yeah<br />
<br />
<br />
37.Does your character have a bad temper at times?<br />
yes<br />
<br />
38.Does your character get depressed?<br />
I dunno<br />
<br />
39.What's your characters favorite animal?<br />
Fish <img src="http://e.deviantart.com/emoticons/e/excited.gif" width="23" height="19" alt=":excited:" title="OMG! I can't contain my excitement!" /><br />
<br />
40.Does your character have any fears?<br />
dark. |D;<br />
<br />
41.Does your character have any weaknesses?<br />
^ See above<br />
<br />
42.Does your character look up to anyone?<br />
Halloween store owner. XD<br />
<br />
43.Does your character like music?<br />
yeah<br />
<br />
<br />
44.What's your character's favorite type of music?<br />
Country<br />
<br />
45.Is he/she impatient?<br />
yeah<br />
<br />
47.Name 5 nicknames.....<br />
I don't know any ):<br />
<br />
48. Does your character curse?<br />
Yeah<br />
<br />
49.This test is over, what does your character have to say?<br />
eh.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>TAGGED</title>
                <link>http://manafimaster.deviantart.com/journal/16108905/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16108905/</guid>
                <pubDate>Wed, 26 Dec 2007 12:12:01 PST</pubDate>
                
                <description><![CDATA[ Tagged by the sweet <a href="http://koolkatt.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/o/koolkatt.gif" width="50" height="50" alt=":iconkoolkatt:" title="koolkatt"/></a> <img src="http://e.deviantart.com/emoticons/h/heart.gif" width="15" height="13" alt=":heart:" title="Heart" /><br />
<br />
1. Post these rules<br />
2. Each tagged person must post their 8 aleatory facts of themselves<br />
3. Tagged deviants should write a journal/blog entry to these facts<br />
4. Tag 8 more people when you're finished<br />
5. Go to their dA page and comment saying they're tagged && hugged<br />
<br />
<br />
1. )  I wanna be a brain surgeon when I grow up, although the people who's been with me longer know this o_o<br />
2.) I like the small of old cars (don't ask about thiss)<br />
3.) I enjoy fine stuff; I just never really have the money or time to go to the museum, so. jksdhfshfiu<br />
4.) My house is haunted, so I freak out at night<br />
5.) My brother claims he "sees things" in the house, but I ignore him about that, & freak him out with his worst enemy: Freddy Crougar, or whatever his name is.<br />
6.) I don't like making friends IRL. I has a lack of social skills, so it gets awkward when someone greets me ._<<br />
7.) I had no cable when I was a kid, so I watched something called Kid'sWB. Back then, it had the greatest shows, or so I thought when I was seven. Its kinda crappy now, so I don't bother watching it again<br />
8.) I draw my persona more than anything else; it ruined my perceptions for life-drawing :/<br />
<br />
I tag anyone whom reads this very journal. End of story.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>GAH.</title>
                <link>http://manafimaster.deviantart.com/journal/16094169/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/16094169/</guid>
                <pubDate>Tue, 25 Dec 2007 13:31:03 PST</pubDate>
                
                <description><![CDATA[ Seriously you guys, did you get a nice Christmas? <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
I got a couple of good things. My family's big, so. <br />
& I'm still little. ._. I got a chia pet (Bart version), art supplies, clothes, teddy bears, & this book.<br />
Its called the Bronche sisters or something like that. 800 pages worth of good stories; old fashioned. Since my dad knows I don't really appreciate modern novels/music. |D<br />
<br />
You guys got..?<br />
<br />
<br />
<br />
<br />
<br />
Anyways, I apologize for being so inactive. I've been drawing lots of traditional stuff, so I'll scan & submit any page that I like best in my sketchbook.<br />
Plus, I've been working a bit with my little "art lessons" ( AKA: <a href="http://inventiontocompletehumanbeing.blogspot.com/">[link]</a> ); I is on lesson 34.<br />
<br />
Sooner or later, I'll find a way to comment more again.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>lol</title>
                <link>http://manafimaster.deviantart.com/journal/15862641/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15862641/</guid>
                <pubDate>Sun, 09 Dec 2007 12:31:16 PST</pubDate>
                
                <description><![CDATA[ I won't be on in the weekDAYS<br />
I must keep those grades up u_u<br />
<br />
got from <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
01) First name:<br />
not tellin', only good friends know this c:<br />
<br />
02) Your nickname in dA:<br />
no clue.<br />
<br />
03) Birthday:<br />
1-3-ninety-something <br />
<br />
04) Horoscope sign:<br />
Capricorn<br />
<br />
05) Birth town:<br />
Pasadena, California<br />
<br />
06) Religion:<br />
catholic. I would've been Muslim/Jewish, but I already had confirmation, or confirming your religion to that for the rest of your life, dshfsdfska<br />
<br />
07) Nationality:<br />
Indian/Spanish/Mexican<br />
<br />
08) Parents:<br />
lol<br />
<br />
09) Do you love them:<br />
yesplz<br />
<br />
10) Brothers or sisters:<br />
7 of them, two don't have a job, & one of their kids have no education, cause they think video games are THATIMPORTANTD<<br />
<br />
11) Do you like the place where you live:<br />
Canadaaaaaa cB<br />
(EDIT: misunderstanding. I like where I live <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /> )<br />
<br />
12) Hair color:<br />
brown & proud<br />
<br />
13) Color of your eyes:<br />
-see 12-<br />
<br />
14) Height:<br />
5' 6"<br />
<br />
15) Weight:<br />
why would I tell you..?<br />
<br />
16) What school/grade are you going to:<br />
7 to 8<br />
<br />
17) What marks do you have:<br />
A's & B's, keeping away from those evil C's<br />
<br />
18) Do you work anywhere:<br />
nah<br />
<br />
19) What do you want to be in your life:<br />
Some weird person who loves to do brain operations.<br />
EDUCATED TOO.<br />
<br />
20) Your life:<br />
On a scale of 1-10, 10 being the best life ever, 1 being it sucks ass: <br />
8<br />
<br />
21) Personal quote:<br />
"just cause, doesn't mean"<br />
it works anywhere |D<br />
<br />
22) Lucky number:<br />
3579 <br />
<br />
23) What are you interested in:<br />
Plays, classic music, Fine arts, nature cause I'm weird like that<br />
<br />
24) Good side of your character:<br />
No clue<br />
<br />
25) Bad side of it:<br />
weird-ass-tail<br />
<br />
26) Is your life happy?<br />
Yeah, sorta. xD<br />
Although I know I overreact sometimes<br />
<br />
27) Do you think that you are crazy?<br />
irl yes<br />
<br />
28) What is the time?<br />
12:13 PM<br />
<br />
29) What is the date?<br />
12/9/07<br />
<br />
30) What's the weather like:<br />
nice. :3<br />
<br />
31) Favorite day in a week:<br />
wednesday<br />
<br />
32) Favorite music:<br />
Classic, Country, I pretty much don't care. Anything but emo or scream-o D;<br />
<br />
34) Band:<br />
The Killers<br />
<br />
35) Song:<br />
Mr. Brightside<br />
<br />
36) Best concert you have been:<br />
I haven't been to one<br />
<br />
37) Actress:<br />
don't know any. ._.<br />
<br />
38) Actor:<br />
whut<br />
<br />
39) Film:<br />
Ice Age, the Master of Disguise, classic Disney movies. XD<br />
anddddd those McDonald Movies, dflsjfaklsjfdlksfj.<br />
<br />
40) TV series:<br />
Bleach, House<br />
<br />
41) Theater play:<br />
I can't remember the name of it, dangit.<br />
Its about this girl who's father died of fever in Africa, & has to be in this girls school. When her dad died, she had to work to stay. She became friends with this Maid, & all of a sudden, THEY BECAME SISTERS O_O<br />
O_O<br />
<br />
42) Film director:<br />
*shrug*<br />
<br />
43) Do you want to be famous:<br />
eff no<br />
<br />
44) Do you want to be an actor/actress:<br />
eff no<br />
<br />
45) Do you want to be a singer:<br />
eff no<br />
<br />
46) Book:<br />
God of the Animals<br />
<br />
49) Food:<br />
bread, seeds<br />
<br />
51) Sweet:<br />
fruit snacks, popcorn balls<br />
<br />
52) Fruit:<br />
pomegranate, pineapple, cherry, & AUGH THEY'RE ALL SO GOOD ><<br />
<br />
53) The worst food:<br />
lobster<br />
<br />
54) The Worst drink:<br />
alcohol<br />
<br />
55) The worst Singer:<br />
Hannah Montana<br />
<br />
56) The worst Band:<br />
High School Musical. -_-<br />
god, I want to shoot them all oneday o:<br />
<br />
57) The worst Actor:<br />
idk<br />
<br />
58) The worst Actress:<br />
Hilary Duff XD<br />
<br />
59) The worst Movie:<br />
They're all good, I don't see any bad ones. <br />
<br />
60) The worst book:<br />
dunno<br />
<br />
61) Do you drink alcohol:<br />
lolno<br />
<br />
62) Do you smoke:<br />
Can't. Even if I could, I wouldn't<br />
<br />
63) Do you take some drugs:<br />
nah<br />
<br />
64) What do you adore to wear:<br />
white shirt & karate pants. JEEZ ITS SO COMFY XD<br />
<br />
65) Do you think you're pretty:<br />
nah<br />
<br />
66) What languages do you speak:<br />
English, a bit of Spanish, barely any Japanese since my fifth grade obsession<br />
<br />
67) The most be... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Gaia? IMVU? whut..?</title>
                <link>http://manafimaster.deviantart.com/journal/15738021/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15738021/</guid>
                <pubDate>Fri, 30 Nov 2007 17:03:10 PST</pubDate>
                
                <description><![CDATA[ This was made by <a href="http://chibipiggy.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/h/chibipiggy.gif" width="50" height="50" alt=":iconchibipiggy:" title="chibipiggy"/></a><br />
<br />
1) Uhh... What's your fave color?<br />
ORANGE.<br />
<br />
2) GaiaOnline? Username?<br />
snapple_island<br />
<br />
3) IMVU?<br />
LOLNO<br />
<br />
4) Boyfriend/girlfriend?<br />
don't need one.<br />
<br />
5) Listening to a song right now? Which one?<br />
Straight Line by Silverchair<br />
<br />
6) Reading a book ATM?<br />
Peace Like a River by Leif Enger<br />
<br />
7) Was that the shortest questionaire you've done?<br />
whut that be?<br />
<br />
<br />
sorry I've been posting nothing as of now TT_TT<br />
I'm working on the DVD's again (Some of you know..? The CD's in drawing anatomical figures?); it got easier after I learned how to draw the skull.<br />
My teacher got me off the habit of drawing during school, so I feel guilt, wtf. <br />
<br />
Anyways, how are you all? <3<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>damn</title>
                <link>http://manafimaster.deviantart.com/journal/15608458/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15608458/</guid>
                <pubDate>Wed, 21 Nov 2007 16:38:15 PST</pubDate>
                
                <description><![CDATA[ tagged by: <a href="http://00nekoyasha00.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/0/0/00nekoyasha00.jpg" width="50" height="50" alt=":icon00nekoyasha00:" title="00nekoyasha00"/></a><br />
<br />
Natural Hair Color:<br />
[ ] Black = $100<br />
[] Blonde = $50 (strawberry blonde :3)<br />
[ ] Red = $75<br />
[x] Brown = $15<br />
[ ] Bald = $5<br />
[ ] Other=$2<br />
<br />
Total: $50<br />
<br />
Eye Color:<br />
[x ] Brown - $150<br />
[] Green - $75<br />
[ ] Blue $50<br />
[ ] Hazel $100<br />
[ ] Other - $15<br />
<br />
Total so far: $165<br />
<br />
Height:<br />
[ ] Over 7' - $200<br />
[ ] 6'8" to 7' - $175<br />
[ ] 6'0" to 6'7" - $150<br />
[x] 5'5" to 5'11" - $75<br />
[ ]4'9" to 5'4" - $50<br />
[ ] Under 4'9 - $45 --<br />
<br />
Total so far: $240<br />
<br />
Age:<br />
[ ] 41 to 50 - $150<br />
[ ] 31 to 40 - $100<br />
[ ] 26 to 30 - $75<br />
[ ] 21 to 25 - $50<br />
[ ] 19 to 20 - $25<br />
[X] 0 to 18 - $100<br />
<br />
Total so far: $340<br />
<br />
Birth Order:<br />
[ ] Twins or more than twins - $300<br />
[ ] First Born - $300<br />
[]Only Child - $250<br />
[ ] second born - $150<br />
[ ] Middle child - $100<br />
[ ] Last Born - $200<br />
[ ] third born - $100<br />
[ ] fourth born - $100<br />
[x] fifth born-$375<br />
<br />
Total so far: $715<br />
<br />
Drink?<br />
[X] No - $400<br />
[ ] Only Holidays - $250<br />
[ ] Sometimes - $215<br />
[ ] YES - $200<br />
[ ] only weekends - $300<br />
[ ] Every other day - $50<br />
[ ] Once a day - $15<br />
[ ] I live from the bottle<br />
<br />
Total so far: $1115<br />
<br />
Vision?<br />
[X] perfect vision $300<br />
[ ] need or have glasses/contacts but don't wear them $200<br />
[ ] No correction $100<br />
[ ] Glasses $50<br />
[ ] contacts $25<br />
[ ] Surgical correction -$135<br />
<br />
Total so far: $1445<br />
<br />
Car Color [or familes' car(s)]:<br />
[x ] White - $2,000<br />
[ ] Maroon - $800<br />
[ ] Gold - $700<br />
[x]Gray - $600<br />
[] Blue - $900<br />
[ ] Pink - $475<br />
[ ]Black - $450<br />
[] Red - $400<br />
[ ] Green- $350<br />
[ ] Silver $300<br />
[ ] Purple- $250<br />
[ ] Metallic - $200<br />
[ ] Yellow - $100<br />
[ ] Primer - $75<br />
[ ] Tan- $20<br />
[ ] Rusted - $15<br />
[ ] No Car - $0<br />
<br />
Total score: $4045<br />
<br />
Shoe Size:<br />
[ ] 13+ - $300<br />
[ ]12 and a half to 13 - $250<br />
[ ] 11 to 12 - $700<br />
[X] 7 to 10 - $600<br />
[ ] Under 7- $550<br />
<br />
Total so far: $4645<br />
<br />
Favorite Colors (three):<br />
[x ] Green-$750<br />
[] Black - $600<br />
[] Red - $800<br />
[ ] Yellow -$475<br />
[ ] Brown - $50<br />
[] Purple - $225<br />
[ ] White - $400<br />
[x ] Aqua - $350<br />
[ x] Orange - $300<br />
[ ] Blue - $300<br />
[ ] Pink - $100<br />
[ ] Other - $ 50<br />
<br />
Total so far: $6045<br />
<br />
Did you use a calculator to add it all up?<br />
[ ] Yes $0<br />
[]No-add $1000<br />
[ x] on some- $750<br />
<br />
Total so far: $6795<br />
<br />
how many people are you going to tag?<br />
[ ] 100-150 = 250,000<br />
[ ] 90 - 80 = $100,000<br />
[ ] 70 -60 = $50,000<br />
[ ] 50 - 40 = $10,000<br />
[ ] 30 - 20 = $5,000<br />
[ ] 20 - 10 = $1,000<br />
[X] 10 - 1 = $500<br />
<br />
<br />
over all Total: $7295<br />
<br />
I tag:<br />
<br />
<br />
ANYONE WHOM WANTS THIS THING.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>meh.</title>
                <link>http://manafimaster.deviantart.com/journal/15582394/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15582394/</guid>
                <pubDate>Mon, 19 Nov 2007 20:29:21 PST</pubDate>
                
                <description><![CDATA[ Sorry I haven't really been commenting in you guys' work lately; I gotta catch up in school. That's the most important thing in my life at this age, anyways~<br />
I'll comment again regularly tomorrow~ <img src="http://e.deviantart.com/emoticons/a/aww.gif" width="15" height="15" alt=":aww:" title="Aww" /><br />
<br />
I decided to do this; I got it from <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a>. I put down what I am, I DO NOT AGREE with the side comment after it.<br />
<br />
If you hate stereotypes and think people should just shut up and stop judging others, then POST THIS! Pick the stereotype that fits you the most, and put it in the subject when you re-post this<br />
<br />
<br />
[ ]I'm EMO, so I MUST cut my wrists.<br />
<br />
[ ]I'm BLACK, so I MUST carry a gun.<br />
<br />
[x]I'm HISPANIC, so I MUST be dirty.<br />
<br />
[ ]I'm ASIAN, so I MUST be smart.<br />
<br />
[X]I'm NOT LIKE EVERYONE ELSE, so I MUST be a loser.<br />
<br />
[ ]I'm JEWISH, so I MUST be greedy.<br />
<br />
[ ]I'm GAY, so I MUST have AIDS.<br />
<br />
[ ]I'm a LESBIAN, so I MUST have a sex-tape.<br />
<br />
[ ]I'm ARAB, so I MUST be a terrorist.<br />
<br />
[]I SPEAK MY MIND, so I MUST be a bitch.<br />
<br />
[x]I'm OVERWEIGHT, so I MUST have a problem with self control.<br />
<br />
[]I'm RELIGIOUS, so I MUST shove my beliefs down your throat.<br />
<br />
[ ]I'm an ATHEIST, so I MUST hate the world.<br />
<br />
[]I DON'T HAVE A RELIGION, so I MUST not have morals.<br />
<br />
[ ]I'm REPUBLICAN, so I MUST not care about poor people.<br />
<br />
[]I'm DEMOCRAT, so I MUST not believe in being responsible.<br />
<br />
[ ]I'm JAMICAN so I must smoke weed.<br />
<br />
[ ]I am LIBERAL, so I MUST be gay.<br />
<br />
[]I'm SOUTHERN, so I MUST be white trash.<br />
<br />
[]I TAKE ANTI-DEPRESSANTS, so I MUST be crazy.<br />
<br />
[ ]I'm a GUY, so I MUST only want to get into your pants.<br />
<br />
[]I'm IRISH, so I MUST have a bad drinking problem.<br />
<br />
[ ]I'm INDIAN, so I MUST own a convenient store.<br />
<br />
[ x]I'm NATIVE AMERICAN, so I MUST dance around a fire screaming like a savage.<br />
<br />
[ ]I'm PREPPY, so I MUST shun those who don't wear Abercrombie & Hollister.<br />
<br />
[ ]I'm a CHEERLEADER, so I MUST be a stuck up whore.<br />
<br />
[ ]I'm on a DANCE team, so I must be stupid, stuck up, and a whore.<br />
<br />
[ ]I wear skirts a lot, so I MUST be a slut.<br />
<br />
[ ]I'm a PUNK, so I MUST do drugs.<br />
<br />
[X]I'm YOUNG, so I MUST be naive.<br />
<br />
[ ]I'm RICH, so I MUST be a conceited snob.<br />
<br />
[]I WEAR BLACK, so I MUST be a goth.<br />
<br />
[ ]I'm BLONDE, so I MUST be a stupid ditz.<br />
<br />
[]I'm a WHITE GIRL, so I MUST be a nagging, steal-your-money kind of girlfriend.<br />
<br />
[ ]I'm CUBAN, so I MUST spend my spare time rolling cigars.<br />
<br />
[x]I'm MEXICAN, so I MUST have hopped the border. (my parents did X: )<br />
<br />
[ ]I'm NOT A VIRGIN, so I MUST be easy.<br />
<br />
[ ]I FELL IN LOVE WITH A MARRIED MAN, so I MUST be a home-wrecking whore.<br />
<br />
[ ]I'm a TEENAGE MOM, so I MUST be an irresponsible slut.<br />
<br />
[ ]I'm POLISH, so I MUST wear my socks with my sandals.<br />
<br />
[ ]I'm ITALIAN, so I must have a big peter.<br />
<br />
[ ]I GOT A CAR FOR MY BIRTHDAY, so I MUST be a spoiled brat.<br />
<br />
[ ]I'm PRETTY, so I MUST not be a virgin.<br />
<br />
[]I HAVE STRAIGHT A'S, so I MUST have no social life. (Used to)<br />
<br />
[]I DYE MY HAIR CRAZY COLORS, so I MUST be looking for attention.<br />
<br />
[]I DRESS IN UNUSUAL WAYS so I MUST be looking for attention.<br />
<br />
[ ]I'm INTO THEATER ART, so I MUST be a homosexual.<br />
<br />
[]I'm a VEGETARIAN, so I MUST be a crazy political activist.<br />
<br />
[]I HAVE A BUNCH OF GUY FRIENDS, so I MUST be fucking them all.<br />
<br />
[X]I HAVE A BUNCH OF GIRLS WHO ARE FRIENDS, so I MUST be gay.<br />
<br />
[]I HAVE BIG BOOBS, so I MUST be a whore.<br />
<br />
[ ]I'm COLOMBIAN, so I MUST be a drug dealer.<br />
<br />
[x]I WEAR WHAT I WANT, so I MUST be a poser.<br />
<br />
[ ]I'm RUSSIAN, so I MUST be cool.<br />
<br />
[]I'm GERMAN, so I MUST be a Nazi.<br />
<br />
[]I hang out with GAYS, so I MUST be GAY TOO<br />
<br />
[ ]I'm BRAZILIAN, so I MUST have a BIG BUTT.<br />
<br />
[ ]I'm PUERTO RICAN, so I MUST look good and be conceited.<br />
<br />
[ ]I'm SALVADORIAN, so I MUST be in MS 13.<br />
<br />
[ ]I'm POLISH, so I MUST be greedy.<br />
<br />
[ ]I'm HAWAIIAN, so I MUST be lazy.<br />
<br />
[ ]I'm a STONER, so I MUST be going in the wrong direction.<br />
<br />
[X]I'm a VIRGIN, so I MUST be a prude.<br />
<br />
[X]I'm a FEMALE GAMER, so I MUST be ugly or crazy.<br />
<br />
[ ]I'm BLACK, so I MUST love watermelon and fried chicken.<br />
<br />
[]I'm BI, so I MUST think every person I see... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>ppsh.</title>
                <link>http://manafimaster.deviantart.com/journal/15509694/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15509694/</guid>
                <pubDate>Wed, 14 Nov 2007 16:10:21 PST</pubDate>
                
                <description><![CDATA[ I got this from: <a href="http://little-wolf-kid.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/l/i/little-wolf-kid.gif" width="50" height="50" alt=":iconlittle-wolf-kid:" title="little-wolf-kid"/></a><br />
<br />
<br />
You can ask me THREE questions<br />
No matter how crazy, inappropriate, or random they are<br />
I will answer 100% truthfully. (or as close to the truth as I can)<br />
<br />
Now Here's The Dare.<br />
You Must Put This in Your Journal<br />
See What Other People Will Ask You.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>you guys</title>
                <link>http://manafimaster.deviantart.com/journal/15427411/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/15427411/</guid>
                <pubDate>Thu, 08 Nov 2007 22:05:23 PST</pubDate>
                
                <description><![CDATA[ ...<br />
I guess. I have to apologize for leaving here.<br />
<br />
I didn't realize that I would hurt people's feelings be taking a break. I didn't MEAN to do that. I guess it was too long?<br />
<br />
I'm sorry, you guys. </3<br />
Hate me if you like; life still isn't going well.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>8)</title>
                <link>http://manafimaster.deviantart.com/journal/14478058/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14478058/</guid>
                <pubDate>Mon, 03 Sep 2007 19:42:37 PDT</pubDate>
                
                <description><![CDATA[ had enough.<br />
<br />
<br />
taking a long break from DA.<br />
<br />
When i come back, all requests will be finished, & posted.<br />
All problems will be solved.<br />
All schoolwork will be done.<br />
<br />
<br />
<br />
<br />
Good day.<br />
<img src="http://e.deviantart.com/emoticons/h/heart.gif" width="15" height="13" alt=":heart:" title="Heart" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>GAH. IM DEADDDDDDDDDDDDDDDDD</title>
                <link>http://manafimaster.deviantart.com/journal/14385057/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14385057/</guid>
                <pubDate>Tue, 28 Aug 2007 18:15:18 PDT</pubDate>
                
                <description><![CDATA[ ...<br />
i..just don't know what to do anymore.<br />
really.<br />
<br />
I've known my best friend for a while.<br />
She taught me so many things,<br />
<br />
from learning to fit in (i prefer not to, though. It'll cause trouble in my grades)<br />
<br />
<br />
to keeping an organized schedule,<br />
<br />
<br />
& all the way to teaching me how do endure everything that i received.<br />
<br />
I don't think I'll have any more friends, tomorrow, when school starts.<br />
<br />
So i can't really depend on anything.<br />
<br />
I don't wanna be social; i can't afford to get any C's, even a B- wouldn't do.<br />
<br />
Guys, should i stay friendless throughout the year, or should i get a social life, & ruin my future report card?<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>;D ;D ;D tagggggggggggggg</title>
                <link>http://manafimaster.deviantart.com/journal/14263568/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14263568/</guid>
                <pubDate>Mon, 20 Aug 2007 21:14:04 PDT</pubDate>
                
                <description><![CDATA[ tagged byyyyyy <a href="http://kitsunexheart.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/i/kitsunexheart.png" width="50" height="50" alt=":iconkitsunexheart:" title="kitsunexheart"/></a><br />
<br />
1-post these rules<br />
2-each person tagged must post 8 random facts about themselves<br />
3-tags should write a journal of these facts<br />
4-at the end of the post 8 more persons are tagged and named<br />
5-go to their page and leave a comment telling them theyÂve been ÂtaggedÂ<br />
<br />
<br />
1. I was a STRICT dragon artist back in third grade. People who go to EDO has seen one of my "old pictures" before.<br />
The only reason i started to draw humans is because i had to draw a self-portrait in fifth, & i KNEW that. :/<br />
It looked like your everyday generic fatass anime xD<br />
<br />
2.  Theres this kid at school, who's always calling me<br />
Hinata. D| I hate that, since i REALLY have a hate for that anime. xD<br />
<br />
3. I constantly vent at EDO, although i don't usually submit it at DA.<br />
Only when i had enough.<br />
<br />
4. I prefer ugly & ill cats/dogs rather than healthy & beautiful ones.<br />
The uglies always have the best personality. ;w;<br />
<br />
5. strangers always stare at me with a disgusted look |D<br />
kinda wierd, since they don't normally do that to my preppy sistahhh<br />
<br />
6. SHI PAINTER<br />
IS NOT<br />
WORKING FOR MEEEEEEEEEEEEEEEEEEE <img src="http://e.deviantart.com/emoticons/c/crying.gif" width="20" height="17" alt=":crying:" title="Crying" /><br />
Neither will Pbbs. ;;<br />
<br />
7. Torsos are my weakness in drawing. ;D<br />
<br />
8. I don't judge by appearance, unlike the rest of the class. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
MY class:<br />
blondes= slut.  ;;<br />
Fat=worthless D;<br />
Sick= GTF away from me. :<<br />
<br />
Now I tag...<br />
<br />
<br />
ANYONE WHO WOULD LIKE TO STEAL DIS QUIZZZZ<br />
<br />
<br />
<br />
<br />
<br />
ah, Oddworld= BEST GAME EVER 8D<br />
<br />
<br />
Really. It's amazingggg, & you have to do all this crap, & there's tons of aliens, etc. ;D<br />
<br />
It's a new addiction to me. <img src="http://e.deviantart.com/emoticons/w/wink.gif" width="15" height="15" alt=";)" title=";) (Wink)" /><br />
<br />
<br />
<img src="http://e.deviantart.com/emoticons/h/heart.gif" width="15" height="13" alt=":heart:" title="Heart" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>:0</title>
                <link>http://manafimaster.deviantart.com/journal/14217044/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14217044/</guid>
                <pubDate>Fri, 17 Aug 2007 20:19:50 PDT</pubDate>
                
                <description><![CDATA[ lol stolen from <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
<br />
THE DEVIANT ART QUIZ<br />
<br />
== You On DA ==<br />
<br />
x When did you join <img src="http://e.deviantart.com/emoticons/d/devartlogo.gif" width="32" height="17" alt=":devart:" title="deviantART" /> ?<br />
October something '06<br />
<br />
x Did you find <img src="http://e.deviantart.com/emoticons/d/devartlogo.gif" width="32" height="17" alt=":devart:" title="deviantART" /> through a friend?<br />
no; I saw lots of people with a deviantart on SSO, so i got one, as well.<br />
<br />
x How old were you when you started?<br />
._.<br />
<br />
x What type of art do you practice?<br />
Manga (NOT anime >8( ), cartoons, occasional realism (occasional like candy 8D),& digital media<br />
<br />
x Any other types of art you enjoy?<br />
*points up*<br />
<br />
x What mediums do you use?<br />
computer, pencil, stump, Crayola pencils <img src="http://e.deviantart.com/emoticons/w/wink.gif" width="15" height="15" alt=";)" title=";) (Wink)" /><br />
<br />
x What are your favorite color choices to use?<br />
green, & yellow<br />
<br />
x How many comments do you usually recieve per deviation?<br />
8.42<br />
<br />
x How many favorites do you usually recieve per deviation?<br />
1.51<br />
<br />
x Are you considered to be popular at <img src="http://e.deviantart.com/emoticons/d/devartlogo.gif" width="32" height="17" alt=":devart:" title="deviantART" /> ?<br />
lol no<br />
<br />
x How many pageviews do you have?<br />
1,700 TwT<br />
<br />
<br />
== You and Friends on DA ==<br />
x Do you have any friends on <img src="http://e.deviantart.com/emoticons/d/devartlogo.gif" width="32" height="17" alt=":devart:" title="deviantART" /> ?<br />
bunches 8)<br />
<br />
x Are they online? Or In Real Life friends?<br />
all online. <br />
<br />
x Who is your best friend, If you have one?<br />
Not telling you guys. o_x<br />
<br />
x Who have you known the longest?<br />
<a href="http://kranlin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/r/kranlin.png" width="50" height="50" alt=":iconkranlin:" title="kranlin"/></a><br />
<br />
But the both of us only hang out at oekaki, she doesn't go to deviantart so much xwx<br />
<br />
x If you had the opportunity to meet any of your DA friends who would it be?<br />
(You know who you are ;D)<br />
<br />
x Have you met any of your DA friends?<br />
I'm saving up :0<br />
<br />
x How long do you think you'll stay in touch with your DA friends?<br />
until i get a job o_x<br />
<br />
== Random on DA ==<br />
<br />
x Who is your favorite artist on DA?<br />
<a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
<br />
x Why are they your favorite artist?<br />
neat manga sketches <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
x Have more than one favorite?<br />
yah 8D<br />
<br />
x How many pictures have YOU favorited?<br />
not so many owo<br />
<br />
x Favorite section to submit in?<br />
digital media<br />
<br />
x Favorite thing to do on DA?<br />
submit deviations |D<br />
<br />
x What's the story behind your username?<br />
um, about a year ago, manafi was pretty new to me. <br />
& master, i really don't know. o_o<br />
I was such a noob back then. XD<br />
<br />
x Have you grown close to DA?<br />
not very, but enough for me to continue checking on updates<br />
<br />
x Do you visit any art sites besides DA?<br />
oekakis, fanart central, etc.<br />
<br />
<br />
<br />
<br />
owo<br />
<br />
I need to go finish everything now; its gonna seem like im not ever gonna draw it. D:<br />
<br />
<br />
Oekakis requests, tryouts, etc. |D<br />
<br />
I'm such an idiot. I'm gonna have to get some caffeine in order to work on my projects. ;D<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>&gt;8)</title>
                <link>http://manafimaster.deviantart.com/journal/14164562/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14164562/</guid>
                <pubDate>Tue, 14 Aug 2007 12:08:09 PDT</pubDate>
                
                <description><![CDATA[ Tagged by <a href="http://biggest-maniac.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/b/i/biggest-maniac.gif" width="50" height="50" alt=":iconbiggest-maniac:" title="biggest-maniac"/></a>  <img src="http://e.deviantart.com/emoticons/s/shakefish.gif" width="50" height="50" alt=":shakefish:" title="I'm in ur post! Shakin mah fish!" /><br />
x3<br />
<br />
The rules:<br />
1. post these rules<br />
2. each person tagged must post 8 random and facts about themselves<br />
3. tags should write a journal of these facts<br />
4. at the end of the post 8 more bloggers are tagged and named<br />
5. go to their page and leave a comment telling them they're tagged (asdfjdsjf too lazy to do that crap)<br />
-------<br />
1. i can't STAND any of my traditional linearts without supersexycoloring & shading & value & composition & all that. x_x<br />
Kinda like those creepy anime fanarts, that put /too/ much color inside.<br />
<br />
2.  Um, i have about 7849732473029408328408 plush toys in my room; collected as a child. My bed is FILLED WITH THEM, but i need to take care of them for now; its hard x_o;<br />
<br />
3. Im currently in a clique with a few people on one of the many weazie oekakis, although I've joined many others, none popular. ;D<br />
4. When i get obsessed with something, it STAYS obsessed for years without end. .__.<br />
<br />
I'm STILL obsessed with AmiYumi. |D<br />
<br />
5. My brother...has many mood swings, & he never lets me in his room, so i put a spoon under the door, to see what he's doing (you've heard of that trick, right?)<br />
6. I draw from midnight, to 2 in the morning; & probably a few more hours in the day. Night is so easy to work with :'3<br />
<br />
7.  I'm sorta pissed right now, but I'm pretty much always pissed about SOMETHING xD<br />
It's never ending. <br />
<br />
8.   ( You know who you are D8&lt<img src="http://e.deviantart.com/emoticons/w/wink.gif" width="15" height="15" alt=";)" title=";) (Wink)" /><br />
RAWKBAWKS WANTS TO EAT ME BECAUSE HE IS SU FAT <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
<br />
<br />
<br />
I TAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG<br />
<br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a> <a href="http://star-cookie.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/t/star-cookie.gif" width="50" height="50" alt=":iconstar-cookie:" title="star-cookie"/></a> <a href="http://eiffelness.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/e/i/eiffelness.gif" width="50" height="50" alt=":iconeiffelness:" title="eiffelness"/></a> <a href="http://arf106.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/a/r/arf106.gif" width="50" height="50" alt=":iconarf106:" title="arf106"/></a> <a href="http://hopeanuoli.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/h/o/hopeanuoli.jpg" width="50" height="50" alt=":iconhopeanuoli:" title="hopeanuoli"/></a> <a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a> <a href="http://cheesey-bean.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/h/cheesey-bean.png" width="50" height="50" alt=":iconcheesey-bean:" title="cheesey-bean"/></a> <a href="http://bluzze.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/b/l/bluzze.png" width="50" height="50" alt=":iconbluzze:" title="bluzze"/></a><br />
<br />
<br />
<br />
<br />
<br />
CLUBS:<br />
<br />
<a href="http://the-zafara-club.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/t/h/the-zafara-club.gif" width="50" height="50" alt=":iconthe-zafara-club:" title="the-zafara-club"/></a> <a href="http://yuki-love.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/y/u/yuki-love.jpg" width="50" height="50" alt=":iconyuki-love:" title="yuki-love"/></a> <a href="http://manaphy-fanclub.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/a/manaphy-fanclub.jpg" width="50" height="50" alt=":iconmanaphy-fanclub:" title="manaphy-fanclub"/></a> <br />
<br />
that's pretty much it. ._.<br />
<br />
OH YEAH, I FORGOT:<br />
<a href="http://coloured-hair-club.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/default.gif" width="50" height="50" alt=":iconcoloured-hair-club:" title="coloured-hair-club"/></a><br />
<br />
REQUESTS: closed<br />
ART TRADES: closed<br />
<br />
<br />
<br />
<br />
XD Does anyone have any tips to draw basic canine anatomy better? <br />
<br />
Since mine really needs work & all |D<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>ASLKJDSA:LJD:AS</title>
                <link>http://manafimaster.deviantart.com/journal/14151021/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14151021/</guid>
                <pubDate>Mon, 13 Aug 2007 14:44:26 PDT</pubDate>
                
                <description><![CDATA[ Stolen from <a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a> <br />
<br />
[x] You have eaten fish food. (EW)<br />
[] You have eaten dog food.<br />
[x] You have eaten cat food.<br />
[ ] You have run into a glass door.<br />
[x ] You have eaten an ant.<br />
[x] You have eaten grass.<br />
[x ] You have licked a tree.<br />
[] You have polka dotted underwear.<br />
[x] You have pink underwear.<br />
[ ] You had contests with your friends to see who can create the loudest burp.<br />
[x ] You have screamed a random word in public.<br />
[] You wave at people you don't know.<br />
[x ] You have flushed the toilet because you were bored.<br />
[x ] You have slapped yourself out of boredom.<br />
[ ] You sing the "FUN" song.<br />
[x] You hold conversations with a pillow, blanket, stuffed animal etc.<br />
[ ] You dream of llamas coming out of peoples' butts.<br />
[x ] You think people who eat brains are cool.<br />
[ ] You sing karaoke even though you know you're horrible.<br />
[ ] You know how to spell "supercallafragalisticespialadosious" by heart.<br />
[x] You make up your own words and use them with people who have no clue what they mean.<br />
[ ] You have a new haircolor every 5-7 months.<br />
[ ] You have striped socks and you have wore them so people can see them.<br />
[ ] You have hugged a random person.<br />
[x] You have ran up+down the stairs cuz u were bored.<br />
[ x] You have created a puppet show with your socks out of boredom.<br />
[x ] You have imagined people saying "bla" and blowing up. (lol vampires owo)<br />
[ ] You just tried imagining people saying "bla" and blowing up.<br />
[ ] You are addicted to the Animaniacs themesong.<br />
[ ] You are addicted to "The Pinky and the Brain" theme song.<br />
[x] You have stared at your ceiling for over 10 minutes.<br />
[x] You talk to yourself.<br />
[X] You have conversations with your imaginary friends.<br />
<br />
multiply by 3 then type "im __% immature"<br />
<br />
<br />
...<br />
<br />
FIFTY-FOUR<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>TAGTAGTAGTAGTAGTAGTAGTAGGGG</title>
                <link>http://manafimaster.deviantart.com/journal/14111955/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14111955/</guid>
                <pubDate>Fri, 10 Aug 2007 21:49:08 PDT</pubDate>
                
                <description><![CDATA[ Tagged by zeh <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
TYPE YOUR NAME WITH YOUR...<br />
<br />
1.FINGERS: Savannah (lol I'm not putting up my real name 8D)<br />
2.CHIN: asccAVBNBZXCF (jdslkjf;l caps)<br />
3.ONE FINGER, EYES CLOSED: savammah<br />
4.ELBOW: savsanmnmsahj<br />
5.NOSE: wqavgahnnah<br />
6.PALM: dfesdvbvanbnbasgbh<br />
<br />
1.) List Four fandoms you have.<br />
<br />
1. Ranma 1/2<br />
2. Bleach<br />
3. H. T .F.<br />
4. Zombie Powder<br />
<br />
2.) Have you ever slept in the back of a car?<br />
not really |D<br />
<br />
3.) Have you recently dyed your hair/cut it?<br />
nope, still long 83<br />
<br />
4.) List four people that you look up to the most.<br />
So..hard to choose >.<<br />
<br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a><br />
<a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
<a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<a href="http://neogirl999202.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/n/e/neogirl999202.png" width="50" height="50" alt=":iconneogirl999202:" title="neogirl999202"/></a><br />
<br />
5.) How many pets do you own as of now?<br />
2 housecats+ 840923847823642374091 strays in the backyard, 2 dogs, 5 fish, 2 iguanas, 2 birds<br />
<br />
6.) Which do you prefer white or black?<br />
White 8D<br />
<br />
7.) i have no idea what your talking about...<br />
...<br />
<br />
die. <img src="http://e.deviantart.com/emoticons/o/ohnoes.gif" width="15" height="15" alt=":ohnoes:" title="Oh Noes!" /><br />
<br />
8.) Choose one or the other, not both:<br />
The one in between "one or the other"<br />
<br />
n__n;<br />
<br />
9.) Name three aspects that tell who you are.<br />
1. Retarded<br />
2. goth (lol check here: <a href="http://www.urbandictionary.com/define.php?term=goths">[link]</a><br />
found it cause of EDO)<br />
3. Half-fat, half skinny ;D<br />
<br />
10.) If you could have a power what would it be?<br />
psychic 83;<br />
<br />
11.) Who was the last person you talked to?<br />
<a href="http://mirin164.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mirin164.gif" width="50" height="50" alt=":iconmirin164:" title="mirin164"/></a><br />
<br />
12.) Who was the last person you said "I love you" to?<br />
Um<br />
<br />
i never said that to anyone since 1st grade, even my parents<br />
<br />
13.) Write down the first five words that pop into your head:<br />
1.) Tamale<br />
2. Taco<br />
3. Tea<br />
4. Crumpets<br />
5. Hippo in a tutu<br />
<br />
14.) What's one thing you wish you could do better?<br />
DRAWWWWWWWWWWWWWWWW<br />
i suck D; <br />
i can't do flexible positions anymore<br />
<br />
15.) Do you like the way you are?<br />
um, sure <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
16.) Choose, Summer or Winter:<br />
winter<br />
<br />
17.) Choose, Rain or snow:<br />
Snow<br />
<br />
18.) Water or ice?<br />
Ice<br />
<br />
19.) List two odd things about yourself:<br />
1.) I reallyreally hate how coincidence happens me /more/ than it should<br />
<br />
(like at my school, anyone i like/hate with a passion, i meet them next to me in cars, in the street, & end up being PE partners with almost all teh time, same groups, etc. >.< Its getting annoying)<br />
2.) I EAT<br />
my Doritos with lemon & spice; fries with lemon, etc.<br />
<br />
#0.-Today you feel like turning into a color, you turn to that color, then the yellow color comes and mixes with you, then the red color, then the white color, then the orange color, then the black color, then the blue color, which color is the resultant to the previous mix?<br />
<br />
lol don't ask that question to a dumb ass 8D<br />
<br />
#1. Answer the first thing that goes into your mind after reading this question, ready?<br />
<br />
PURPLE PANCAKES <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
#2.- The word "bargest" makes you think about WHAT?<br />
<br />
<img src="http://e.deviantart.com/emoticons/c/cry.gif" width="15" height="15" alt=":cry:" title="Crying" /><br />
<br />
#3.- What is your response to someone who just yelled "DUN DUUUN" at you?<br />
<br />
*punch*<br />
<br />
#4.-Delicious is to Pizza, while craptastic is to---<br />
<img src="http://e... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>YOU MUST CHECK DEES' OUT &gt;8(</title>
                <link>http://manafimaster.deviantart.com/journal/14097931/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14097931/</guid>
                <pubDate>Thu, 09 Aug 2007 22:43:49 PDT</pubDate>
                
                <description><![CDATA[ ahah, i got this from ~<a class="u" href="http://usagi-moni.deviantart.com/">Usagi-Moni</a><br />
<br />
The rules:<br />
The first "ten"people who reply to this Journal get put up here, along with three of my favorite deviations by them. People who will be put up here must make the same feature in their Journal. No cheating!<br />
<br />
1.) <a href="http://claudeio.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/l/claudeio.gif" width="50" height="50" alt=":iconclaudeio:" title="claudeio"/></a><br />
<a href="http://www.deviantart.com/deviation/56794844/">[link]</a><br />
Aw c'mon, who doesn't love Rainbow umbrellas? : D<br />
<br />
<a href="http://www.deviantart.com/deviation/61646467/">[link]</a><br />
INSTANT WIN. <img src="http://e.deviantart.com/emoticons/l/love.gif" width="23" height="16" alt=":love:" title="Love" /><br />
<br />
<a href="http://www.deviantart.com/deviation/61914037/">[link]</a><br />
amazing sketch thar :3<br />
<br />
2.) <a href="http://miss-silber.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/miss-silber.gif" width="50" height="50" alt=":iconmiss-silber:" title="miss-silber"/></a><br />
<a href="http://www.deviantart.com/deviation/61739127/">[link]</a><br />
this...is obvious <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
<a href="http://www.deviantart.com/deviation/59183067/">[link]</a><br />
Well, its detailed & all, so yah |D<br />
<br />
<a href="http://www.deviantart.com/deviation/52788054/">[link]</a><br />
THIS LOOKS<br />
pretty awesome 8D<br />
<br />
3.) <a href="http://risu-wolf.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/r/i/risu-wolf.gif" width="50" height="50" alt=":iconrisu-wolf:" title="risu-wolf"/></a><br />
<a href="http://www.deviantart.com/deviation/55015150/">[link]</a><br />
Damn, this is cute :3<br />
<br />
<a href="http://www.deviantart.com/deviation/60313893/">[link]</a><br />
GREAT sonic char design <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
<a href="http://www.deviantart.com/deviation/56438878/">[link]</a><br />
lawl eyes <br />
THEY BE PRETT ;D<br />
<br />
4.) <a href="http://bluenx.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/b/l/bluenx.gif" width="50" height="50" alt=":iconbluenx:" title="bluenx"/></a><br />
<a href="http://www.deviantart.com/deviation/59078542/">[link]</a><br />
The shading---THEY PWN ME D8<br />
<br />
<a href="http://www.deviantart.com/deviation/56617352/">[link]</a><br />
Detail, Detail, Detail; who can't get enough of it? <img src="http://e.deviantart.com/emoticons/d/dance.gif" width="29" height="21" alt=":dance:" title="Dance!" /><br />
<br />
<a href="http://www.deviantart.com/deviation/61937243/">[link]</a><br />
HER HUMANS<br />
are really quite spiffy. <img src="http://e.deviantart.com/emoticons/s/smile.gif" width="15" height="15" alt=":)" title=":) (Smile)" /><br />
<br />
5.) <a href="http://hopeanuoli.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/h/o/hopeanuoli.jpg" width="50" height="50" alt=":iconhopeanuoli:" title="hopeanuoli"/></a><br />
<a href="http://www.deviantart.com/deviation/57617629/">[link]</a><br />
XD Compared to the rest of her gallery; i like this <i>plain</i> one. 83<br />
<br />
<a href="http://www.deviantart.com/deviation/58471130/">[link]</a><br />
Thar we go. More spiffy humans.<br />
<br />
<a href="http://www.deviantart.com/deviation/59711379/">[link]</a><br />
This is just too adorable <img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="OMG" /><br />
<br />
6.) <a href="http://ardenn.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/a/r/ardenn.png" width="50" height="50" alt=":iconardenn:" title="ardenn"/></a><br />
<a href="http://www.deviantart.com/deviation/50017044/">[link]</a><br />
such pretty realism o3o<br />
<br />
<a href="http://www.deviantart.com/deviation/60386557/">[link]</a><br />
Why WOUDN'T i put fanart up as my top 3 favs? <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
<a href="http://www.deviantart.com/deviation/61252288/">[link]</a><br />
CUTECUTECUTE. <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
<br />
7.) <a href="http://mirin164.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mirin164.gif" width="50" height="50" alt=":iconmirin164:" title="mirin164"/></a><br />
<a href="http://www.deviantart.com/deviation/60539501/">[link]</a><br />
Lol fat 8D <3<br />
<br />
<a href="http://www.deviantart.com/deviation/55845674/">[link]</a><br />
n____n;<br />
<br />
<a href="http://www.deviantart.com/deviation/54432047/">... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Well dudes;</title>
                <link>http://manafimaster.deviantart.com/journal/14063988/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/14063988/</guid>
                <pubDate>Tue, 07 Aug 2007 17:55:05 PDT</pubDate>
                
                <description><![CDATA[ Well guys,<br />
<br />
i had a <i>dream</i> |D<br />
<br />
*shotshotshot*<br />
<br />
Well, here's the basic info. TwT;<br />
<br />
Um, my persona; her sibling, whom she lives with, is unable to afford anything, even food; since he lost his job. So she has to go to those homeless community things xD.<br />
<br />
While getting her food, she barges in to those emperor things |D, by accident.<br />
<br />
It's those really really mean ones, so she was ordered to get executed, & the killer would receive anything he/she desires, from saving the rain forest (lulz), to becoming the emperor him/herself. So all of Chinaaaaaaaaaaa (she's Korean, but i decided to make her live in china, since EVERY CHAR LIVES IN JAPAN/ IS JAPANESE THESE DAYS?!?! XD) is <br />
OUT TO GET HER D8 D8 D8<br />
<br />
She runs & runs, getting scraps out of trash, etc., like a stray dog. <br />
She can't trust her family anymore. <br />
She can't trust her friends.<br />
<br />
Everyone that has offered to take her in (which is rare), dies.<br />
<br />
The first person, *augh, i gotta make out a design for him xD* lived the longest; 6 months. She ends up developing<br />
<i>feeeeeeeeeeeeeeeelingsssssssssssssssssss s</i> for him |D<br />
& <br />
he dies.<br />
lul, & she continues.<br />
<br />
She eventually goes out of country, in Vietnam.<br />
<br />
As soon as the emperor realized that (it took a few weeks), He ordered for all of asiaaaaaaaaaaaaaaaaaaaa & the US to find her.<br />
     Everyone soon gave her wierd looks, & one tried to mug her XDDD<br />
So she knew that He informed other countries as well.<br />
She sighed (djhfjsdfjkash i wanted to put that on |D This is just a SUMMARY, dudes), & went on. <br />
She found lots of seafood, though.<br />
<br />
She soon burst into tears; accidentally inside someones house.<br />
Luckily, the owner offered to take her in (If you watch Bleach, you should know who Kukaku shiba is. The owner looks a bit like her.)<br />
<br />
The owner, whom currently has no name, introduced her to another girl, Oblivion (or my zombie chara). <br />
   At first, she was paralyzed of fearrrrrrrr, then they became quick friends.<br />
<br />
Zeh owner owned a halloween store/costume store, so she knew how to disguise the two of them.<br />
<br />
    Instead of handmade clothes that Savannah had, she gave her detailed clothing (here it is: <a href="http://i141.photobucket.com/albums/r66/manafimaster/oekaki/kkk.jpg">[link]</a> ) ; & dyed her hair into many colors, along with contacts; that blurred her vision slightly, since her eyes were horizontal. She saw like a regular person could (horizontal pupils let you see the sides, while seeing the front at the same time, more clearly, sorta like goat vision 8D). <br />
She gave oblivion a mask & sum moar stuffz, to cover all the flesh.<br />
    They were able to go anywhere without feeling the everyday pressure that was on them. Soon after, she met<br />
her MOMMETH D8<br />
thennn she died & all that crap, along with enemies that i must design also. :<<br />
<br />
<br />
This was my DREAM 83<br />
(well, edited a bit. i was a small goblin thing, like Rumpelstiltskin XDDD)<br />
<br />
<br />
<br />
<br />
Well, i have to:<br />
<br />
1.) FINISH <a href="http://xaiphin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/x/a/xaiphin.jpg" width="50" height="50" alt=":iconxaiphin:" title="xaiphin"/></a>'s request to color a picture; it's kinda late <img src="http://e.deviantart.com/emoticons/a/animesweat.gif" width="19" height="19" alt="^^;" title="Sweating a little..." /><br />
<br />
2.) COMPLETE <a href="http://claudeio.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/l/claudeio.gif" width="50" height="50" alt=":iconclaudeio:" title="claudeio"/></a>'s request, BAD. It's late as hell D8<br />
<br />
3.) finish updated references for all me characters; ESPECIALLY my persona. <br />
|D She changed a lot.<br />
<br />
4.) finish all fanarts i promised<br />
<br />
5.) finish <a href="http://mittster500.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mittster500.jpg" width="50" height="50" alt=":iconmittster500:" title="mittster500"/></a>'s spam trade<br />
<br />
6.) Be more active at <a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a>'s oekaki<br />
<br />
7.) FINISH ALL SAFETY SAVES.<br />
NAO >8(<br />
<br />
<br />
;skf;lsdkfskd'f<br />
I'm wondering to either write the story, like a book, or make it into a manga. TwT<br />
<br />
<br />
Bye deuds.<br />
<br />
FRIENDSSSSSSSSSSSSSSSS (in the order of my memory 83)<br />
<br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a> <a href="http://xanderchan.deviantart.... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>EVEN MORE TAGINESSSS</title>
                <link>http://manafimaster.deviantart.com/journal/13958775/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13958775/</guid>
                <pubDate>Tue, 31 Jul 2007 15:40:08 PDT</pubDate>
                
                <description><![CDATA[ tagged by: <a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
v<br />
The Tag game!!!! it's easy to play!<br />
just list 5 things that make you giggle/snicker/laugh and label them with the correct guffaw.<br />
<br />
1. ummmmmmmmmmmmmmmmmm,<br />
Stupid sayings..?<br />
2. ...<br />
I..really don't laugh that much |D<br />
Maybe when my brother keeps losing on Mario Kart64 (It's the only usable game so far in my house D8 everything else is either boring or broken)<br />
3. My fishes constantly swim upside down, then get back to their original state XD<br />
But there might be something wrong with their bladder. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
4. Anything beyond retarded<br />
5. ...<br />
<br />
YOUUUUUUUUUUUUUUUUUUUUUUUU D8<br />
<br />
i tag<br />
<br />
(you don't have to do this if you don't want to/is too lazy to do so |D)<br />
<a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<a href="http://chibiharrypotter.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/h/chibiharrypotter.gif" width="50" height="50" alt=":iconchibiharrypotter:" title="chibiharrypotter"/></a><br />
<a href="http://risu-wolf.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/r/i/risu-wolf.gif" width="50" height="50" alt=":iconrisu-wolf:" title="risu-wolf"/></a><br />
<a href="http://ghost-lover.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/g/h/ghost-lover.gif" width="50" height="50" alt=":iconghost-lover:" title="ghost-lover"/></a><br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a><br />
<a href="http://bluzze.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/b/l/bluzze.png" width="50" height="50" alt=":iconbluzze:" title="bluzze"/></a><br />
<a href="http://neogirl999202.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/n/e/neogirl999202.png" width="50" height="50" alt=":iconneogirl999202:" title="neogirl999202"/></a><br />
<br />
<br />
<i>Only if you want to. </i> <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
Oh yeah, should i keep moving on with the dvd's..? |D;<br />
so far i have 12 lessons down, & they get more complex as it goes; so its harder for me to remember all of it.<br />
I guess i should. :/<br />
<br />
<br />
<br />
<br />
<br />
Anyways; those of you who know about the Sroekaki's (if you don't; check =<a class="u" href="http://kuitsuku.deviantart.com/">Kuitsuku</a>'s journal. :< );<br />
I'm planning to try out for SRON. xD;<br />
What should i improve on..? c:<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>TAGGED YET AGAIN, DEUDSSS</title>
                <link>http://manafimaster.deviantart.com/journal/13943503/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13943503/</guid>
                <pubDate>Mon, 30 Jul 2007 15:22:17 PDT</pubDate>
                
                <description><![CDATA[ Tagged byyyyyyyyyyy zeh : <a href="http://ghost-lover.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/g/h/ghost-lover.gif" width="50" height="50" alt=":iconghost-lover:" title="ghost-lover"/></a><br />
<br />
1. Grab the book nearest to you, turn to page 18, and find line 4.<br />
*visual/picture book'd x_x*<br />
2. Stretch your left arm out as far as you can.What can you reach?<br />
DVD set 8D<br />
<br />
3. What is the last thing you watched on TV?<br />
King of the Hill from 5 weeks ago. D;<br />
<br />
4. Without looking guess what time it is?<br />
(bah, i already peeked xD)<br />
<br />
5. Now look at the clock. What is the actual time?<br />
2:39<br />
<br />
6. With the exception of the computer, what can you hear?<br />
Fish filter |D<br />
<br />
7. When did you last step outside? What were you doing?<br />
10 Minutes ago; just watched the Simpsons Movie. :0<br />
<br />
8. Before you started this survey, what did you look at?<br />
...<br />
Pokemon book 8D<br />
<br />
9. What are you wearing?<br />
New shirt; jeans as well<br />
<br />
10. Did you dream last night?<br />
|D<br />
I was camping with people from around zeh world; the majority being 7-8ish; & asian (i thought they had a lot of money xD Well; dreams don't really do accurate for you 8( ) .<br />
So,<br />
when i got off teh SAFARI BUSSSSSSSSSS 8D i looked around.<br />
There was a ginourmous T-Rex Chasing a 7 year old. 8D<br />
so i slapped it on the faceeee (lulz) & I paused the...<br />
game.. .-. Not so sure. It was to keep the dinosaur at put; & to help the child catch his breath. Then i unpaused when i figured he had enough time; & soon got back into the  dream (wierd, huh xD?)<br />
Then,<br />
I met hte harry potter author |D (J.K. Rowling, right?)<br />
& figured if i could read the books she made (never read a single one in real life 83) <br />
Well, she asked me to write a report; & it suddenly became a class.<br />
Preps were preps; lazies were lazies. They got wh00ped by a<br />
YARDSTICK 8D<br />
Then, i suddenly drew like a god. |3<br />
Professional concepts + realism in 2 seconds flat. 8D<br />
<br />
Afterwards; I got back in the t rex drama. oh joy. D|<br />
It threw a burning wrench. Hurt like hell. (you can imagine a tiny-armed t rex throwing a 4024829384923 lb wrench. |D<br />
So i got mah <br />
MALLET<br />
& busted the hell out of that thing. |D<br />
Except afterwards it was a <br />
FRIGGIN' STUFFED TOY D':<br />
I really dislike killing those. xD<br />
(since my heart is cold against people; warm against objects & FUUD 83)<br />
So I gave the toy to the child; & it ended up eating him. |D<br />
My old camp leaderrrrrrrr (from Science camp 8D She & the preps were energetic as hell. x_x; Me & my BFF couldn't really keep up at camp xD), Miri. c:<br />
We got to breakfast, & there ended up being the dude i dream just about every night (ughhhhhhhhh D; ), along with his "you're friggin ugly so go die now fat girl" look. <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
Dammit. He couldn't stop staring at me with that look. <br />
Then his table looked at me also. x_o;<br />
Then A random chainsaw dude cut their leader alive. 8D<br />
Looked Like Jason from that one horror movie. |3<br />
<br />
I ran & ran, carrying my BFF with me; & ended up <i>magically</i><br />
Being the Bleach world. |D<br />
Ichigo was fighting Narutoooooooooo 8D<br />
& Naruto kept dying; reviving; dying; reviving; within seconds. <br />
So Ichigo was winning.<br />
<br />
Inoue & Kuchiki was slapping the hell out of me xD, & then i ended up being in an explosion. cB<br />
<br />
END. :3<br />
11. When did you last laugh?<br />
dunno deud.<br />
Probably at <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.jpg" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a>'s RP we had? <img src="http://e.deviantart.com/emoticons/s/shrug.gif" width="15" height="15" alt=":shrug:" title="Shrug" /><br />
<br />
12. What are on the walls you are in?<br />
Plush toys; & dragonnnnnnnnnnn posters. |3<br />
<br />
13. Seen anything weird lately?<br />
No. .0.<br />
<br />
14. What do you think of this quiz?<br />
It's wasting away my short life 8D<br />
<br />
15. What was the last film you saw?<br />
Simpsons Movieeeeeeeee<br />
<br />
16. If you became a multi-millionaire overnight, what would you buy?<br />
Um<br />
BLEACH SPREEEEEEEEEEEEE 8)<br />
<br />
17. Tell me something about you that I don't know?<br />
Um<br />
I think<br />
<br />
THE WORLD<br />
IS <b><i>HOLLOW</i></b> <img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="OMG" /><br />
&<br />
that dreams are just a taste of what the afterlife is going to be like. :3<br />
<br />
18. If you could change one thing about the world, regardless of guilt and politics, what would i... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Taggeddddddddddddddddddd</title>
                <link>http://manafimaster.deviantart.com/journal/13902588/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13902588/</guid>
                <pubDate>Fri, 27 Jul 2007 14:36:38 PDT</pubDate>
                
                <description><![CDATA[ Tagged by <a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
<br />
1. Do you like animals?<br />
sure, sure, from a fly to a dog. 8D<br />
<br />
2. Have you ever met an online friend in person?<br />
not really. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
3. Are you athletic?<br />
ugh, i hate sports x3<br />
<br />
4. Are you: thin, fat, athletically built etc: hmm atm?<br />
athletically built; but i choose not to do so |D<br />
<br />
5. Girls - are you tomboyish, girly, normal, etc?<br />
100% tomboy D8<<<<br />
<br />
6.How old are you?<br />
D8 noteskplzthx<br />
<br />
7. Do you like to receive giftart?<br />
alright. <3<br />
<br />
8. Are you sociable?<br />
TwT; hell no.<br />
<br />
9. Do you have many friends?<br />
mm, in real life, i have three. :3<br />
<br />
One of them (Vietnamese) likes Bleach as much as i do ^_^<br />
Another (Mexican) draws with talent, & I've been with her since kindergarten<br />
Last (also mexican) knows how it is for the world to BETRAY YOUUUUUU D8<br />
<br />
In the net; i have quite a bit 8D<br />
<br />
10. What's your race?<br />
100% Mexican 8)<br />
but my skin is lighter than usual for one <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
11. Do you like to talk on the phone?<br />
depends on who's calling me D|<br />
<br />
12. Are you single or taken?<br />
DAMMIT IM SINGLEjdsfjaslkdjflasdjflsdjlsdjf<br />
D8<<<< <br />
<br />
13. Do you eat meat?<br />
again, it depends.<br />
<br />
If they serve it on a plate (unless its <img src="http://e.deviantart.com/emoticons/s/spam.gif" width="25" height="21" alt=":spam:" title="Spam" /> <img src="http://e.deviantart.com/emoticons/m/mad.gif" width="15" height="15" alt=":x" title=":x (Mad)" /> )<br />
I'll eat it. But i never eat it on my will.<br />
<br />
14. Are you paranoid? <br />
whuttttttttt<br />
<br />
15. Do you read a lot?<br />
no, unless it is<br />
TEH MANGAAA >8D<br />
<br />
21. Do you listen to music, what kind?<br />
any type; just hand it over<br />
<br />
22. Do you play any instruments?<br />
used to. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
23. How long have you been drawing?<br />
since i was 5 months old (I'll scan it soon >.< )<br />
<br />
24. What's the meaning of life?<br />
dunno 8(<br />
<br />
25. Tag a buncha people! They MUST take this quiz and post it in their journal!<br />
<br />
<a href="http://bluzze.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/b/l/bluzze.gif" width="50" height="50" alt=":iconbluzze:" title="bluzze"/></a><br />
<a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.jpg" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a><br />
<a href="http://neogirl999202.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/n/e/neogirl999202.png" width="50" height="50" alt=":iconneogirl999202:" title="neogirl999202"/></a><br />
<a href="http://cooper113355.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/o/cooper113355.png" width="50" height="50" alt=":iconcooper113355:" title="cooper113355"/></a><br />
<a href="http://skietheeevee.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/k/skietheeevee.jpg" width="50" height="50" alt=":iconskietheeevee:" title="skietheeevee"/></a><br />
<a href="http://reversed-pocky.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/r/e/reversed-pocky.gif" width="50" height="50" alt=":iconreversed-pocky:" title="reversed-pocky"/></a><br />
<a href="http://ggsoulsister.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/g/g/ggsoulsister.jpg" width="50" height="50" alt=":iconggsoulsister:" title="ggsoulsister"/></a><br />
<br />
(all good friends so far <3)<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>blehhh I got the dvdssssssssssssssss~</title>
                <link>http://manafimaster.deviantart.com/journal/13861048/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13861048/</guid>
                <pubDate>Tue, 24 Jul 2007 14:07:55 PDT</pubDate>
                
                <description><![CDATA[ eek.<br />
<br />
Losing one of my friends=NOT COOL D8<br />
(I'm NOT mentioning names >8( )<br />
<br />
whateverrrr. At least she's a lot more popular at SS oekaki, & has 34723473247823932047 friends alongside with it. ^_^<br />
<br />
so..8(<br />
<br />
<br />
Anyways; I got my dvddddddddddddds today 8D<br />
8D<br />
8D<br />
<br />
I'm happyyyyyyyyyyyyyy (not really D; )<br />
The DVDS<br />
WORKED BETTER THAN EXPECTED D8<br />
Fo' sure. xD i understood human anatomy pretty easily, but im only at the guidelines x3<br />
So expect some traditional art (since this thing is 43 hours long, i think, I cant do digital art at the moment. digital stuff takes 1-8 hours, so bleh D|)<br />
until i finish the dvds. :3<br />
<br />
Or<br />
i might do digital art, as a break. <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>jklfjadlfjsdalfasldk ughhhhhhh ;;</title>
                <link>http://manafimaster.deviantart.com/journal/13840012/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13840012/</guid>
                <pubDate>Mon, 23 Jul 2007 00:00:09 PDT</pubDate>
                
                <description><![CDATA[ mm. ;~;<br />
<br />
Dammit.<br />
dammit.<br />
<br />
<a href="http://i141.photobucket.com/albums/r66/manafimaster/oekaki/yyyyyyyyyyyyyyyyyyyyyyyyyyyy.png">[link]</a><br />
This took well-over 3 days to finish (Paintbbs is so hard to use x3), & my sister just TURNED off the entire computer without noticing that. <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
<br />
fklajsdlkfjlskdjfal;<br />
I was literally crying because of that. No one really cared anywhere; not in oekakis nor real life. ugh.<br />
<br />
<br />
Even more things are happening.<br />
<br />
I'm sure i only told ONE watcher of mine about the "style theft" i cought someone doing to me.<br />
<br />
<br />
I KNOW that I'm overreacting, but...<br />
mm, COMBINING both my animal AND chibi style is just..<br />
going overboard. D||<br />
I really feel hurt when things like that happen.<br />
I might leave that place if it continues.<br />
And she might get away with my style. I don't care anymore.<br />
<br />
But i don't wanna change my style, either. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
Then there's some friendship/family problems that i don't want to talk about.<br />
<br />
<br />
Its one of those times when you feel like you want death; even though you KNOW that that's entirely wrong.<br />
(I'm not going to commit anything bad, so don;t worry )<br />
<br />
Dammit.<br />
I'm too sensitive. </3<br />
<br />
At least my DVD's are coming in a few days; that should cheer me up. 8(<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>:0</title>
                <link>http://manafimaster.deviantart.com/journal/13807673/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13807673/</guid>
                <pubDate>Fri, 20 Jul 2007 11:21:47 PDT</pubDate>
                
                <description><![CDATA[ Yayyyyyyyyyyyyyyyyyyy.<br />
<br />
YAYYYYYYYYYYYYYYYYYYY.<br />
<br />
<br />
<br />
MAH DAD FINALLY AGREED TO BUY ME THISSSS:<br />
<a href="http://thestructureofmandvd.blogspot.com/">[link]</a><br />
<br />
<br />
it's gonna be so fun <img src="http://e.deviantart.com/emoticons/e/excited.gif" width="23" height="19" alt=":excited:" title="OMG! I can't contain my excitement!" /><br />
<br />
SINCE<br />
I always loved drawing that type of stuff 83<br />
<br />
But don't worry; I'm only using this to improve my anatomy & provide a new ref for <a href="http://www.deviantart.com/deviation/56496350/">[link]</a> , & for some other stuff, like torsos & hands. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
So you'll still see teh same amount of stylized drawings. |D<br />
I think it should come in a week. :3<br />
<img src="http://e.deviantart.com/emoticons/w/winkrazz.gif" width="15" height="15" alt=";P" title="Wink/Razz" /><br />
<br />
<br />
<br />
<br />
However, I'm not entirely sure if it'll work.<br />
whatever. D|<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Tagged D8</title>
                <link>http://manafimaster.deviantart.com/journal/13784705/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13784705/</guid>
                <pubDate>Wed, 18 Jul 2007 17:00:30 PDT</pubDate>
                
                <description><![CDATA[ tagged by<br />
THE ONE & ONLY <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
<br />
<br />
<br />
01) First name:<br />
Sandraaaaaaa <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
02) Your nickname in dA:<br />
mana, i think <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
03) Birthday:<br />
Jan 3<br />
<br />
04) Horoscope sign:<br />
Capricorn<br />
<br />
05) Birth town:<br />
Pasadena, CA<br />
<br />
06) Religion:<br />
...8(<br />
<br />
07) Nationality:<br />
Mexican-Americannnnn <img src="http://e.deviantart.com/emoticons/n/nod.gif" width="15" height="15" alt=":nod:" title="Nod" /><br />
<br />
08) Parents:<br />
bleh D:<br />
<br />
09) Do you love them:<br />
it doesn't really matter to me.<br />
'cause I'm cold-hearted like that. <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
<br />
10) Brothers or sisters:<br />
7 currently exist in this world, one which has a mental disability,<br />
another which is in Greece, currently <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
<br />
11) Do you like the place where you live:<br />
Sure, sure, whatevah D|<br />
<br />
12) Hair color:<br />
brownish<br />
<br />
13) Color of your eyes:<br />
brownish<br />
<br />
14) Height:<br />
D:<<br />
<br />
15) Weight:<br />
HOW DARE THEE<br />
<br />
16) What school/grade are you going to:<br />
7 th :3<br />
<br />
17) What marks do you have:<br />
A, A-, B+, B so far in my report card <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
18) Do you work anywhere:<br />
no, too lazy 8D<br />
<br />
19) What do you want to be in your life:<br />
Surgeon<br />
<br />
20) Your life:<br />
needs a whoopin'<br />
<br />
21) Personal quote:<br />
''Just cause', doesn't mean."<br />
<br />
22) Lucky number:<br />
3,579<br />
(they're all odd <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /> )<br />
<br />
23) What are you interested in:<br />
Muscles, Organs, Fishies, Skeletons, drawings, anime, Asian writing, all since i was 4 :3<br />
<br />
24) Good side of your character:<br />
Protective, will do anything for friends, EVEN FOR HER OWN LIFE. D8<br />
*olddddddddddd XD*<br />
<br />
25) Bad side of it:<br />
Can destroy objects & buildings quickly if angered :0<br />
<br />
26) Is your life happy?<br />
Its alright, but it's so-so D|<br />
<br />
27) Do you think that you are crazy?<br />
HELL YUS D:<<<<br />
<br />
28) What is the time?<br />
4:21 pm<br />
<br />
29) What is the date?<br />
7/18/07<br />
<br />
30) What's the weather like:<br />
No air conditioning D8<br />
I'M DYING<br />
<br />
31) Favorite day in a week:<br />
WEDNESDAY 8D<br />
<br />
32) Favorite music:<br />
NOT FOR YOU TO KNOW D:<<br />
<br />
34) Band:<br />
SAME AS <br />
...<br />
wait, where's 33? <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
<br />
35) Song:<br />
...<img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
<br />
36) Best concert you have been:<br />
haven't been to one before. :<<br />
<br />
37) Actress:<br />
no have oneeee<br />
<br />
38) Actor:<br />
no have oneeeeeeeeee<br />
<br />
39) Film:<br />
ICE AGE #1 >:3<br />
<br />
40) TV series:<br />
Bleachhhhhhhhhhhhhhhhhhhhhhhhhhh D8<br />
<br />
41) Theater play:<br />
never been to a play <img src="http://e.deviantart.com/emoticons/s/shrug.gif" width="15" height="15" alt=":shrug:" title="Shrug" /><br />
<br />
42) Film director:<br />
Don't know any XD<br />
<br />
43) Do you want to be famous:<br />
No<br />
IT WILL TORTURE MAH SOUL <img src="http://e.deviantart.com/emoticons/o/ohnoes.gif" width="15" height="15" alt=":ohnoes:" title="Oh Noes!" /><br />
<br />
44) Do you want to be an actor/actress:<br />
nope, no voice, no good action in me D:<br />
<br />
45) Do you want to be a singer:<br />
Nope<br />
<br />
46) Book:<br />
Twilight 8D<br />
<br />
49) Food:<br />
PINEAPPLE D:<<br />
NUFF' SAID.<br />
<br />
51) Sweet:<br />
Taffy <img src="http://e.deviantart.com/emoticons/n/nod.gif" width="15" height="15" alt=":nod:" title="Nod" /><br />
<br />
52) Fruit:<br />
YOU SHOULD KNOW BY NOW IF YOU'RE A FRIEND <img src="http://e.deviantart.com/emoticons/c/crying.gif" width="20" height="17" alt=":crying:" title="Crying" /><br />
<br />
53) The worst food:<br />
Fish food <img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="O... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Eep. Not good. o_x</title>
                <link>http://manafimaster.deviantart.com/journal/13744800/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13744800/</guid>
                <pubDate>Sun, 15 Jul 2007 13:27:42 PDT</pubDate>
                
                <description><![CDATA[ I'm not really sure what happened.<br />
<br />
My mouse skills..<br />
<br />
just <i>broke down</i> all of a sudden, & I have no tablet, nor a tabbie pen.<br />
<br />
so guys, after one(maybe more) of the trades are done, You're going to be seeing a lot of traditional art from me. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
Fo' serious.<br />
<br />
I'm not comfortable with my mouse art anymore.<br />
So<br />
<br />
maybe if i get the hang of photoshop, or have upload access on oekaki (I'm sure i do on a few of them 8D ), i can scan my pictures & finish them from there; I've done it a couple of times. ^_^;<br />
But Oekaki will die on me. <img src="http://e.deviantart.com/emoticons/o/ohnoes.gif" width="15" height="15" alt=":ohnoes:" title="Oh Noes!" /><br />
<br />
so whatever.  D|<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>LIEK. WE NEED TACOS HERE TO LIVEE D8</title>
                <link>http://manafimaster.deviantart.com/journal/13713827/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13713827/</guid>
                <pubDate>Thu, 12 Jul 2007 22:08:13 PDT</pubDate>
                
                <description><![CDATA[ STOLEN FROMMMMMMMMMM<br />
<a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
<br />
<br />
Write down four of your OCs (original characters):<br />
Savannah Miller<br />
Lime Rice<br />
Krunch<br />
Namco Orimo<br />
(you probably haven't seen half of them yet. xD here: <a href="http://www.deviantart.com/deviation/59163640/">[link]</a> )<br />
<br />
Questions:<br />
<br />
1) How would you describe yourself?<br />
<br />
Savannah- Boring, Annoying, bla bla blaa D|<br />
Lime Rice- Would I Even friggin' care D:<?!<br />
Krunch:  Dude.<br />
stop pissing yourself & get a life.<br />
Go do something thats actually worthy of  your time.<br />
Orimo: I am beautifulz<br />
&<br />
YOU KNOW IT >8(<br />
<br />
2) How would you describe your creator?<br />
<br />
Savannah: She draws me too much on paper. ITS CREEPY <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
Lime Rice: Boringgggggg<br />
Krunch: 2/10<br />
Orimo: Selfishly obsessed with all things D:<<br />
<br />
3) Would you steal your creator's date?<br />
<br />
Savannah: She doesnt have one, dumbuttt. >:/<br />
Lime Rice: Consider genders next time, JERK D8<br />
<img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="OMG" /><br />
Krunch: no reason to, why would i? <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
Orimo: yessssssssssssssssssssssss <br />
yessssssssssssssssssssssssssssssss<br />
FOR ALL THE YES IN THE WORLD <img src="http://e.deviantart.com/emoticons/n/nod.gif" width="15" height="15" alt=":nod:" title="Nod" /><br />
<br />
4) Are you gay?<br />
<br />
Savannah: DEUD.<br />
QUIT IT. <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
Lime Rice: No.<br />
No. NO. Are you freakin' high or something? <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
Krunch: ...<br />
stupid. immature. go die in hell & never come back.<br />
Orimo: ...<br />
MAYBE. 8D<br />
<br />
5) Are you modeled after anyone real-life?<br />
Savannah: probably my creator, but nothing else. :L<br />
Lime Rice: The yu-gi-oh dude, MIXED WITH MEGAMAN 8D<br />
Krunch: Not that i know of. :/<br />
Orimo: noppppppeeeeee D8<br />
IM SO ASHAMED.<br />
<br />
6) If a tree falls down and there's no one around to hear it, would it still make a sound?<br />
<br />
Savannah: DUH. DUHHHHHHHHHHHHHHHHHHHHHHHH<br />
THAT IS WHY SOUND WAVES WERE CREATED BY WHOEVER CREATED IT. D:<<<<br />
Lime Rice: um, no? <img src="http://e.deviantart.com/emoticons/a/animesweat.gif" width="19" height="19" alt="^^;" title="Sweating a little..." /><br />
Krunch: what savannah said. would it matter any less in life?<br />
Orimo: NO, STUPID.<br />
NO SOUND EQUALS NO TREE. D8<<<<br />
<br />
7) Would you act in a soap opera?<br />
<br />
Savannah: if i get some monies, yes 8D<br />
Lime Rice: D8<br />
*offended*<br />
Krunch: Don't have the voice.<br />
Don't have the time.<br />
Orimo: UMGGGGGGGGGGGGGGGG<br />
HOW DID YOU KNOW THAT WAS MY #1 DREAM <img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="OMG" /> ?!<br />
YESSSSSSSSSS YES YES YESSSSS <img src="http://e.deviantart.com/emoticons/e/excited.gif" width="23" height="19" alt=":excited:" title="OMG! I can't contain my excitement!" /><br />
<br />
8) Which among your creator's friends list would you want to hang out with?<br />
<br />
Savannah: i have a few. Here's a quick grocery list.<br />
~<a class="u" href="http://katgirl123.deviantart.com/">Katgirl123</a><br />
~<a class="u" href="http://neogirl999202.deviantart.com/">neogirl999202</a><br />
=<a class="u" href="http://cooper113355.deviantart.com/">cooper113355</a><br />
~<a class="u" href="http://skietheeevee.deviantart.com/">skietheeevee</a><br />
~<a class="u" href="http://ggsoulsister.deviantart.com/">Ggsoulsister</a><br />
~<a class="u" href="http://4verme.deviantart.com/">4verme</a><br />
~<a class="u" href="http://darrie102.deviantart.com/">darrie102</a><br />
~<a class="u" href="http://bluzze.deviantart.com/">bluzze</a><br />
*<a class="u" href="http://tailia-star.deviantart.com/">tailia-star</a><br />
Lime Rice: Im not going to meet them. NO REASON to do that, neh?<br />
Krunch: No point. no. <br />
orimo: UMG EVERYONEEEEEEEEEEEEEEEEEEEEE <img src="http://e.deviantart.com/emoticons/g/giggle.gif" width="17" height="15" alt=":giggle:" title="Giggle" /><br />
<br />
9) What would be your own trademark quote?<br />
<br />
Savannah: "just cause, doesn't mean. now gtfo of my face. >8("<br />
Lime Rice: "whut"<br />
Krunch: "no"<br />
Orimo: "WANNA HANG OUT WIT MEEEEEEEEEE?!!!??" 8D<br />
<br />... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>|D; yay for taginesssssssss</title>
                <link>http://manafimaster.deviantart.com/journal/13687515/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13687515/</guid>
                <pubDate>Tue, 10 Jul 2007 20:15:32 PDT</pubDate>
                
                <description><![CDATA[ Tagged by ~<a class="u" href="http://usagi-moni.deviantart.com/">Usagi-Moni</a><br />
<br />
"The player of this "game" starts with the topic "6 weird habits/things about yourself" and people who get tagged need to write a journal about their 6 weird habits/things as well as stating the rules clearly. In the end, you need to choose the next 6 people to be tagged and list their names. Don't forget to leave a comment that says "you are tagged" in their devpage comments and tell them to read yours..."<br />
<br />
Mine...<br />
(1) Im a friggin oekaki-clean freak. if the lines are dirty, i would beizer it. D:< (but that happens all the time, so <img src="http://e.deviantart.com/emoticons/a/animesweat.gif" width="19" height="19" alt="^^;" title="Sweating a little..." /> )<br />
<br />
(2) I take notes on anything on a daily basis 8D;<br />
<br />
(3) I have about 10-20 stray cats in my backard, all being taken care of, along with 3 house cats; 2 died early <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
<br />
(4) Anything related to Naruto & I'd snap like that 8D;;<br />
<br />
(5) Ummmmmmmmmmmmmmmmmmm<br />
I pretend mah persona is mah councilor 83<br />
<br />
(6)  Im sure my perceptional filters are different than others; i can do basics well but it takes a hell of a long time to get the details, usually taking 1-2 years <img src="http://e.deviantart.com/emoticons/o/ohnoes.gif" width="15" height="15" alt=":ohnoes:" title="Oh Noes!" /><br />
<br />
Now for the added questions:<br />
<br />
1- Find the book nearest to you, go to page 18, find line 4:<br />
Bicuspid Valves are flap-like valves that reign inside your heart, that<br />
<br />
2- Stretch out your left arm as far as you can:<br />
<img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
<br />
3- Last thing you watched on TV?:<br />
dunno X3<br />
<br />
4- Without looking, what time is it?:<br />
5:07<br />
<br />
5- Now, what is the actual time?:<br />
4:55<br />
<br />
6- Without the computer, what do you hear?:<br />
cellphone o_x<br />
<br />
7- When did you last step outside?:<br />
A LONG time 8D<br />
<br />
8- Before you took this survey, what did you look at?:<br />
random bug :3<br />
<br />
9- What are you wearing?:<br />
Bright yellow-t-shirt<br />
<br />
10- Did you dream last night?:<br />
yupperz |D<br />
<br />
11- When did you last laugh?<br />
3 min. o.o ago<br />
<br />
12- What is on the walls in the room you are in?<br />
posters, postersm posterssssssssss <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
13- See anything weird lately?:<br />
Not really <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
14- What do you think of this quiz?:<br />
boringggggggg<br />
<br />
15- What is the last film you saw?:<br />
Willy Wonkaaaaaaa <img src="http://e.deviantart.com/emoticons/o/omg.gif" width="15" height="15" alt=":omg:" title="OMG" /><br />
<br />
16- If you became a multi-millionaire overnight, what would you buy?:<br />
Nothing, i'd wait till something bad occurs. :/<br />
<br />
17- Tell me something I don't know about you:<br />
Currently studying anatomy, hoping to be a surgeon<br />
<br />
18- If you could do one thing about the world without guilt or politics what would you do?:<br />
i don't..really know. Dl<br />
<br />
19- Do you like to dance?:<br />
no. <img src="http://e.deviantart.com/emoticons/b/blankstare.gif" width="15" height="15" alt=":|" title=":| (Blank Stare)" /><br />
<br />
20- George Bush:<br />
D:<<<<<<<<<< STFU.<br />
<br />
21- Imagine your first child is a girl, what is her name?:<br />
Savannah, like mah persona <img src="http://e.deviantart.com/emoticons/w/wink.gif" width="15" height="15" alt=";)" title=";) (Wink)" /><br />
<br />
22- Imagine you first child is a boy, what is his name?:<br />
dunno<br />
<br />
23- Would you consider living abroad?:<br />
whuttttttttttttt is that? 8D<br />
<br />
24- What do you want God to say to you when you reach heaven?:<br />
...<br />
i dont want him to say anything. I wouldnt care any less o-x<br />
25. Tag six people who must do this in their journal:<br />
<br />
<a href="http://kittybounce.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/i/kittybounce.gif" width="50" height="50" alt=":iconkittybounce:" title="kittybounce"/></a><br />
<a href="http://jessiepo.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/j/e/jessiepo.gif" width="50" height="50" alt=":iconjessiepo:" title="jessiepo"/></a><br />
<a href="http://mittster500.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mittster500.jpg" width="50" height="50" alt=":iconmittster500:" title="mittster500"/></a><br />
<a href="http://ggsoulsister.dev... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>:D oh yeiz</title>
                <link>http://manafimaster.deviantart.com/journal/13647988/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13647988/</guid>
                <pubDate>Sat, 07 Jul 2007 15:00:49 PDT</pubDate>
                
                <description><![CDATA[ PEOPLE,<br />
PEOPLE.<br />
<br />
<br />
<br />
<br />
I WANT<br />
<br />
AN ART TRADE. 8D<br />
if anybody's up for it, say so. <img src="http://e.deviantart.com/emoticons/c/chainsaw.gif" width="49" height="20" alt=":chainsaw:" title="Chainsaw" /><br />
<br />
<br />
<img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
first come first serve.<br />
<br />
<br />
on the other hand, <a href="http://www.bleachexile.com/">[link]</a> got upgraded. D:<br />
i like it, but eh..<br />
it just doesnt feel <i>right</i> anymore. xD<br />
other mangas such as naruto or air gear are up at the corner. |D;<br />
it doesnt feel like 100% bleachy stuff.<br />
&<br />
i might be making a series. :0<br />
im not exactly sure yet, hence i suck at storytelling & stuff like that. 8D<br />
<br />
hah, my mom gave me wayyyyyyyy too much pineapple for me to eat. im gonna be stuffed soon. <img src="http://e.deviantart.com/emoticons/l/lol.gif" width="15" height="15" alt=":lol:" title="LOL" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>WHUTTTTTTTT</title>
                <link>http://manafimaster.deviantart.com/journal/13624419/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13624419/</guid>
                <pubDate>Thu, 05 Jul 2007 17:46:00 PDT</pubDate>
                
                <description><![CDATA[ DUDE.<br />
<br />
NOT COOL. D:<<br />
<br />
<br />
My fourth of July wreaked of badness. |D;<br />
<br />
First, we had to pick up my brother, whom id 30 but acts like a hyper 11-12 year old. 8( all well, he's had his times. :/<br />
<br />
Second of all, we had to pick up my sister's bf, which wasnt good. ><'<br />
<br />
All they did all night long was baby-talk & smooch. D;<br />
<br />
when we got there, the majority of people that came were /really/ dumb, only looking for opposite genders, & yah. O-O;<br />
it burned mah brainzzzzzzzzzzz D8<br />
They made so much fun of me. |D<br />
<br />
Then, the worst part came 8<<br />
<br />
The popcornnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnn<br />
IT WAS SOLD OUT <img src="http://e.deviantart.com/emoticons/n/noes.gif" width="15" height="15" alt=":noes:" title="Noes!" /><br />
<br />
sooo we had to buy one off a random dude. :3<br />
NOT THE RIGHT SIZE, THOUGH XD;<br />
but it was cool. :> i wasnt able to eat less than half of it, anyways. <img src="http://e.deviantart.com/emoticons/a/animesweat.gif" width="19" height="19" alt="^^;" title="Sweating a little..." /><br />
<br />
<br />
Fireworks were great, but people kept throwing some beach balls at eachother. l3<br />
it bonked on my head, & many laughed. 8D<br />
<br />
Fireworks were good.<br />
Trip home was good.<br />
Ate a lemon afterwards. ^_^;<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>:0</title>
                <link>http://manafimaster.deviantart.com/journal/13597116/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13597116/</guid>
                <pubDate>Tue, 03 Jul 2007 19:25:27 PDT</pubDate>
                
                <description><![CDATA[ o<br />
m<br />
gawwwwwwdddddddddddddddddddddd<br />
<br />
<br />
<br />
the fourth of july is tomorrow. :><br />
<br />
im so excitedddd <img src="http://e.deviantart.com/emoticons/e/excited.gif" width="23" height="19" alt=":excited:" title="OMG! I can't contain my excitement!" /><br />
<br />
i cant wait to see the fireworks, see a track race, & <br />
ESPECIALLY<br />
<br />
get them HUGE popcorn bags the size of myself (IF i get the right size) 8D;;<br />
'cause<br />
its candied & salted &* delicious at the same time. n__n;<br />
they're really tasty, too. :3<br />
ill send a picture of it later.<br />
its gonna be so funnnnn~ ^____^;<br />
<br />
i cant wait XD ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13526574/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13526574/</guid>
                <pubDate>Thu, 28 Jun 2007 14:19:47 PDT</pubDate>
                
                <description><![CDATA[ third time i got tagged. <img src="http://e.deviantart.com/emoticons/r/razz.gif" width="15" height="15" alt="=P" title="=P (Razz)" /><br />
<br />
this time i got tagged by <a href="http://skietheeevee.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/k/skietheeevee.jpg" width="50" height="50" alt=":iconskietheeevee:" title="skietheeevee"/></a><br />
<br />
1.) I draw more than 12 hours a day <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
2.) Apples are mah love <img src="http://e.deviantart.com/emoticons/n/nod.gif" width="15" height="15" alt=":nod:" title="Nod" /><br />
<br />
3.) coincidence happens often to me. X3<br />
<br />
4.) :0<br />
<br />
5.) Usually when i sleep; i dream of school, & /only/ my enemies/friends/crushes are in it. :3<br />
<br />
6.) Pancakes taste nasty with syrup <img src="http://e.deviantart.com/emoticons/m/mad.gif" width="15" height="15" alt=":x" title=":x (Mad)" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>11 signs your crazy for someone</title>
                <link>http://manafimaster.deviantart.com/journal/13501324/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13501324/</guid>
                <pubDate>Tue, 26 Jun 2007 17:00:33 PDT</pubDate>
                
                <description><![CDATA[ 11 signs your crazy for someone!!<br />
<br />
<br />
â¥ELEVEN:<br />
<br />
You walk really slow when you're with them.<br />
<br />
<br />
<br />
â¥TEN:<br />
<br />
You feel shy whenever they're around.<br />
<br />
<br />
<br />
â¥NINE:<br />
<br />
You smile when you hear their voice.<br />
<br />
<br />
<br />
â¥EIGHT:<br />
<br />
When you look at them, you can't see the other people around you, you just see him/her.<br />
<br />
<br />
â¥SIX:<br />
<br />
They're all you think about.<br />
<br />
<br />
<br />
â¥FIVE:<br />
<br />
You realize you're always smiling when you're looking at them.<br />
<br />
<br />
<br />
â¥FOUR:<br />
<br />
You would do anything for them, just to see them.<br />
<br />
<br />
<br />
â¥THREE:<br />
<br />
While reading this, there was one person on your mind this whole time.<br />
<br />
<br />
<br />
â¥TWO:<br />
<br />
You were so busy thinking about that person, you didnt notice number seven was missing<br />
<br />
<br />
<br />
â¥ONE:<br />
<br />
You just scrolled up to check & are now silently laughing at yourself.<br />
<br />
<br />
NOW MAKE A WISH. YOU KNOW YOU WANT TO......<br />
<br />
<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥ â¥<br />
<br />
<br />
â¥<br />
<br />
<br />
â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥ â¥<br />
<br />
â¥<br />
<br />
<br />
â¥<br />
<br />
â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥ â¥<br />
<br />
â¥<br />
<br />
<br />
ALMOST THERE<br />
<br />
<br />
â¥<br />
<br />
â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥â¥<br />
<br />
â¥â¥â¥â¥<br />
<br />
â¥â¥â¥<br />
<br />
â¥ â¥<br />
<br />
â¥<br />
<br />
Post this as : 11 signs your crazy for someone<br />
<br />
â¥And something good will happen to you tonight.<br />
<br />
â¥If you don't... you'll certainly regret not doing so<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13486473/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13486473/</guid>
                <pubDate>Mon, 25 Jun 2007 14:28:20 PDT</pubDate>
                
                <description><![CDATA[ XD tagged again by <a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
<br />
RULES<br />
<br />
The 1st player of this "game" starts with the topic "6 weird habits/things/hates about yourself" and people who get tagged MUST write a journal about their 6 weird habits/things/hates as well as state this rule clearly. In the end, you need to choose the next 6 people to be tagged and list their names. Don't forget to leave a comment that says "you are tagged" in their devpage comments and tell them to read yours.<br />
<br />
1.) if i don't have any gum, i end up chewing my own hair lD;<br />
<br />
2.)i don't like the fact that i feel outcasted everywhere i go :L<br />
<br />
3.) i dislike hte fact that i don't feel bad, or don't feel anything at all when one i care dies (cat,friends, relatives, etc)<br />
<br />
4.)i have an expired chocolate collection; one being about 4 years old; 5 in jan. <img src="http://e.deviantart.com/emoticons/r/razz.gif" width="15" height="15" alt="=P" title="=P (Razz)" /><br />
<br />
5.) i always drew neopets back in third grade (i can scan & upload here, if you like. ;3)<br />
<br />
6.) i read a heck of a lot of bleach. xD;<br />
if a page doesnt load, i turn a bit hysterical. 8D;<br />
<br />
i shall tag~<br />
<a href="http://skietheeevee.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/k/skietheeevee.jpg" width="50" height="50" alt=":iconskietheeevee:" title="skietheeevee"/></a> <a href="http://ggsoulsister.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/g/g/ggsoulsister.jpg" width="50" height="50" alt=":iconggsoulsister:" title="ggsoulsister"/></a> <a href="http://hannahstar5.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/h/a/hannahstar5.gif" width="50" height="50" alt=":iconhannahstar5:" title="hannahstar5"/></a> <a href="http://reversed-pocky.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/r/e/reversed-pocky.gif" width="50" height="50" alt=":iconreversed-pocky:" title="reversed-pocky"/></a> <a href="http://paintedkanvas.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/p/a/paintedkanvas.gif" width="50" height="50" alt=":iconpaintedkanvas:" title="paintedkanvas"/></a> <a href="http://ardenn.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/a/r/ardenn.png" width="50" height="50" alt=":iconardenn:" title="ardenn"/></a><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>^_^;</title>
                <link>http://manafimaster.deviantart.com/journal/13362131/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13362131/</guid>
                <pubDate>Fri, 15 Jun 2007 21:58:32 PDT</pubDate>
                
                <description><![CDATA[ taken from a friend; <a href="http://halfdemonninja.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/h/a/halfdemonninja.jpg" width="50" height="50" alt=":iconhalfdemonninja:" title="halfdemonninja"/></a> :L<br />
<br />
1- I'll answer with something random about you.<br />
2- I'll dare you to try something.<br />
3- I'll say a color I associate with you.<br />
4- I'll tell you something I like about you.<br />
5- I'll tell you something I always remember about you / a first memory about you.<br />
6- I'll tell you what animal you remind me of.<br />
7- I'll ask you something I always wanted to ask you.<br />
8- If I do this for you, you must put this in your journal. (actually you don't have to but feel free to do so)<br />
<br />
Comment away~ <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13348681/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13348681/</guid>
                <pubDate>Thu, 14 Jun 2007 21:41:19 PDT</pubDate>
                
                <description><![CDATA[ Tagged by <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
01) First name: Sandra <img src="http://e.deviantart.com/emoticons/r/razz.gif" width="15" height="15" alt="=P" title="=P (Razz)" /><br />
02) Your nickname in dA: mana/manafi<br />
03) Birthday: January 3<br />
04) Horoscope sign: Capricorn<br />
05) Birth town: Pasadena, CA <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
06) Religion: whut<br />
07) Nationality: Mexican-American<br />
08) Parents: pshaw, it'd be obvious D:<<br />
09) Do you love them: eh, not really, but still..<img src="http://e.deviantart.com/emoticons/a/animesweat.gif" width="19" height="19" alt="^^;" title="Sweating a little..." /><br />
10) Brothers or sisters: 3 brothers; 4 sisters<br />
11) Do you like the place where you live: not really D8<br />
12) Where would you move to live forever?: Canada~ 8D<br />
13) Color of your eyes: Brown<br />
14) Height: Somwher between around 5' 10"<br />
15) Weight: how dare you D8< *leh slap*<br />
16) What school/grade are you going to: 7th :3<br />
17) What marks do you have: none<br />
18) How many piercings do you have, and where are them?: none at all <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
19) What do you want to be in your life: Medical Surgeon<br />
20) Your life: Alright. <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
21) Personal quote(s): "just 'cause, doesnt mean"<br />
22) Lucky number: 3579<br />
23) What are you interested in: creativity<br />
24) Good side of your character: "randomly compassionate; isnt hesitant when helping someone"<br />
25) Bad side of it: random tantrums<br />
26) Is your life happy: average :0<br />
27) Do you think that you are crazy: yuppers :3<br />
28) What is the time: 9:17 pm<br />
29) What is the date: June 14 2007<br />
30) What's the weather like: normally dry in normal days C:<br />
31) Favourite day in a week: Wednesday<br />
32) Favourite music: i dont care D:<br />
33) Singer: dont know any<br />
34) Band: whut<br />
35) Song: whut<br />
36) Best concert you have been to: whut<br />
37) Actress: whut<br />
38) Manga: "Eureka 7"<br />
39) Film: Ice Age<br />
40) TV serial: Bleach~ X3<br />
41) Theatre play: whut<br />
42) Film director: dont know any lD;<br />
43) Do you want to be famous: no, too much pressure <img src="http://e.deviantart.com/emoticons/w/winkrazz.gif" width="15" height="15" alt=";P" title="Wink/Razz" /><br />
44) Do you want to be an actor/actress: No<br />
45) Do you want to be a singer: nope<br />
46) Book: "Twighlight"<br />
47) Colors: Lavender<br />
48) Flower(s): daffodil<br />
49) Food: fahitas<br />
50) Drink: banana shake<br />
51) Sweet: Taffy<br />
52) Fruit: pineapple <img src="http://e.deviantart.com/emoticons/b/boogie.gif" width="25" height="25" alt=":boogie:" title="Boogie!" /><br />
53) The worst food: chili <img src="http://e.deviantart.com/emoticons/m/mad.gif" width="15" height="15" alt=":x" title=":x (Mad)" /><br />
54) The worst Drink: Vegetable Juice<br />
55) The worst Singer: whut<br />
56) The worst Band: huh<br />
57) The worst Actor: dont know that much<br />
58) The worst Actress: <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
59) The worst Movie: not sure <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
60) The worst book: not sure<br />
61) Do you drink alcohol: <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
62) Do you smoke: Nope<br />
63) Do you take some drugs: no thanks sir. Dl<br />
64) What do you adore to wear: My white Hoodie :3<br />
65) Do you think you're pretty: not at all ^_^<br />
66) What languages do you speak: Eniglish, and *a bittt* of Spanish<br />
67) The most beautiful person you have ever seen/male: not for hte public to know. : x friends can note me, though~<br />
68) The most beautiful person you have ever seen/female: Mah sistah<br />
69) The most beautiful person on dA/male: not sure<br />
70) The most beautiful person on dA/female: <a href="http://ichi-tan.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/i/c/ichi-tan.gif" width="50" height="50" alt=":iconichi-tan:" title="ichi-tan"/></a><br />
71) 5 best friends on dA/male: dont htink i have any <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
72) 5 best friends on dA/female: <a href="http://cooper113355.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/o/cooper113355.png" width="50" heig... ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13270301/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13270301/</guid>
                <pubDate>Fri, 08 Jun 2007 20:25:20 PDT</pubDate>
                
                <description><![CDATA[ crap.<br />
<br />
<br />
its been recently discovered, that my cat has leukemia; & might be put down. <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
she's really weak, too(the 3 legs arent helping much >< ); & she wont eat anything, even if my sister /directly/ puts the food in her mouth.<br />
all she does is spit it out. :<br />
i really hope my kitty gets better, although its not as possible. ~3~<br />
<br />
end of story. :/<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>science camp D8</title>
                <link>http://manafimaster.deviantart.com/journal/13044063/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13044063/</guid>
                <pubDate>Mon, 21 May 2007 20:55:09 PDT</pubDate>
                
                <description><![CDATA[ tomorrow, im going to camp, in the mountains, like <a href="http://cooper113355.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/o/cooper113355.gif" width="50" height="50" alt=":iconcooper113355:" title="cooper113355"/></a> is. :l<br />
(but we're not going to meet each other; hence we're at opposite sides of the country)<br />
so for the next four days, don't expect me to be capable of answering any comments/notes xD;;.<br />
<br />
so, wish me luck~ :><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13040394/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13040394/</guid>
                <pubDate>Mon, 21 May 2007 16:07:28 PDT</pubDate>
                
                <description><![CDATA[ Tagged by <a href="http://usagi-moni.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/u/s/usagi-moni.gif" width="50" height="50" alt=":iconusagi-moni:" title="usagi-moni"/></a><br />
<br />
1. Do you like animals?<br />
yuppers <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
<br />
2. Have you ever met an online friend in person?<br />
no<br />
<br />
3. Are you athletic?<br />
nope <img src="http://e.deviantart.com/emoticons/m/mad.gif" width="15" height="15" alt=":x" title=":x (Mad)" /><br />
<br />
4. Are you: thin, fat, athletically built etc:<br />
between fat & skinny <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
5. How much do you weigh?<br />
whut<br />
6. What's your height?<br />
5 & a half, i think(in feet)<br />
<br />
7. Shoe size?<br />
7.5<br />
<br />
8. Girls - are you tomboyish, girly, normal, etc?<br />
tomboyish or normal, depending on my mood<br />
<br />
10. How old are you?<br />
78392473247239847329 Dl<br />
(not for you to know)<br />
11. When is your birthday?<br />
1-3<br />
<br />
12. Do you like to receive giftart?<br />
it wouldnt matter any less to me, but i at least appreciate them for doing it. <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
13. Are you sociable?<br />
depending on how well i know the person; i don't go full-out crazy against people i dont trust<br />
<br />
14. Do you have many friends?<br />
not really<br />
15. What's your race?<br />
Mexican(which explains why im capable of understanding a bit)<br />
<br />
16. Do you like to talk on the phone?<br />
not as much as regular people do<br />
17. Are you single or taken?<br />
Single -w-<br />
18. Do you eat meat?<br />
yeah<br />
19. Are you paranoid?<br />
no<br />
20. Do you read a lot?<br />
...no. Dl<br />
<br />
21. Do you listen to music, what kind?<br />
any kind is ok for me. <img src="http://e.deviantart.com/emoticons/b/biggrin.gif" width="15" height="15" alt=":D" title=":D (Big Grin)" /><br />
<br />
22. Do you play any instruments?<br />
i used to. :/<br />
23. How long have you been drawing?<br />
since 5 months when i was born, or if seriously, summer vacation of fourth grade<br />
24. What's the meaning of life?<br />
no clue -3-<br />
<br />
25. Now tag five of your friends! They MUST take this quiz and post it in their journal.<br />
<a href="http://skymal3.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/s/k/skymal3.gif" width="50" height="50" alt=":iconskymal3:" title="skymal3"/></a><br />
<a href="http://mimiyu.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mimiyu.gif" width="50" height="50" alt=":iconmimiyu:" title="mimiyu"/></a><br />
<a href="http://kranlin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/r/kranlin.png" width="50" height="50" alt=":iconkranlin:" title="kranlin"/></a><br />
<a href="http://mittster500.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mittster500.gif" width="50" height="50" alt=":iconmittster500:" title="mittster500"/></a><br />
<a href="http://1hikarinaito1.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/1/h/1hikarinaito1.png" width="50" height="50" alt=":icon1hikarinaito1:" title="1hikarinaito1"/></a><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13031050/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13031050/</guid>
                <pubDate>Sun, 20 May 2007 20:49:57 PDT</pubDate>
                
                <description><![CDATA[ 1.Grab the book nearest to you, turn to page 18, and find line 4.<br />
c.) "Examine your models of Geometric Solids."<br />
2.Stretch your left arm out as far as you can.<br />
o-o alright..<br />
<br />
3. What is the last thing you watched on TV?<br />
Malcom in the Middle<br />
<br />
4. Without looking, guess what time it is:<br />
8:59<br />
<br />
5. Now look at the clock. What is the actual time?<br />
8:30<br />
6. With the exception of the computer, what can you hear?<br />
my brother playing monopoly ( & bragging about winning)<br />
7. When did you last step outside? What were you doing?<br />
3 hours ago; i was riding a few rides from the school fiesta <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
<br />
8. Before you started this survey, what did you look at?<br />
paypal for <a href="http://thestructureofmandvd.blogspot.com/">[link]</a> <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
<br />
9. What are you wearing?<br />
purple, short-sleeved shirt<br />
10. Did you dream last night?<br />
yah, but i was supposedly at school (like everyday!) in my dream.<br />
11. When did you last laugh?<br />
5 hours ago. >D<br />
<br />
12. What are on the walls you are in?<br />
...nothing.<br />
13. Seen anything weird lately?<br />
no, not really<br />
14. What do you think of this quiz?<br />
its quite boring. Dl<br />
<br />
15. What is the last film you saw?<br />
Gladiator<br />
<br />
16. If you became a multi-millionaire overnight, what would you buy?<br />
i'd split to my best friends, then save the rest, for something i might want in the future. <img src="http://e.deviantart.com/emoticons/s/smile.gif" width="15" height="15" alt=":)" title=":) (Smile)" /><br />
<br />
17. Tell me something about you that I don't know.<br />
im currently trying to find a flea market with one of this: <a href="http://www.consumeraffairs.com/images02/lucas.jpg">[link]</a><br />
(so far i haven't seen any ><!)<br />
18. If you could change one thing about the world, regardless of guilt or politics, what would you do?<br />
i would probably unban lotsa mexican candies that were actually banned, like the one above<br />
19. Do you like to dance?<br />
yus. n_n;<br />
<br />
20. George Bush:<br />
lulwhut<br />
<br />
21. Imagine your first child is a girl, what do you call her?<br />
Mixtly<br />
22. Imagine your first child is a boy, what do you call him?<br />
Brian <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" /><br />
<br />
23. Would you ever consider living abroad?<br />
whats that 8D?<br />
24. What do you want God to say to you when you reach the pearly gates?<br />
i have absolutely no clue o-o<br />
<br />
25.Tag six people who must also do this in THEIR journal<br />
<a href="http://ghost-lover.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/g/h/ghost-lover.png" width="50" height="50" alt=":iconghost-lover:" title="ghost-lover"/></a><br />
<a href="http://mittster500.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mittster500.gif" width="50" height="50" alt=":iconmittster500:" title="mittster500"/></a><br />
<a href="http://xaiphin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/x/a/xaiphin.jpg" width="50" height="50" alt=":iconxaiphin:" title="xaiphin"/></a><br />
<a href="http://ardenn.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/a/r/ardenn.png" width="50" height="50" alt=":iconardenn:" title="ardenn"/></a><br />
<a href="http://kranlin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/r/kranlin.png" width="50" height="50" alt=":iconkranlin:" title="kranlin"/></a><br />
<a href="http://hope-and-fate.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/h/o/hope-and-fate.jpg" width="50" height="50" alt=":iconhope-and-fate:" title="hope-and-fate"/></a><br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/13003158/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/13003158/</guid>
                <pubDate>Fri, 18 May 2007 16:04:38 PDT</pubDate>
                
                <description><![CDATA[ <img src="http://e.deviantart.com/emoticons/f/frown.gif" width="15" height="15" alt=":(" title=":( (Sad)" /><br />
<br />
since youtube started deleting all the anime, i can't find any anime(such as pani poni dash! & blood +), other than popular ones. <br />
<br />
so i have nothing to do, for now. :/<br />
but <br />
whatever; drawing's my only option now. X3<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
          <item>
                <title>Devious Journal Entry</title>
                <link>http://manafimaster.deviantart.com/journal/12957470/</link>
                <guid isPermaLink="true">http://manafimaster.deviantart.com/journal/12957470/</guid>
                <pubDate>Mon, 14 May 2007 18:50:08 PDT</pubDate>
                
                <description><![CDATA[ lol tagged by <a href="http://4verme.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/4/v/4verme.jpg" width="50" height="50" alt=":icon4verme:" title="4verme"/></a> <img src="http://e.deviantart.com/emoticons/r/razz.gif" width="15" height="15" alt="=P" title="=P (Razz)" /><br />
<br />
The Rules of this "Tagging Game"<br />
The 1st player of this "game" starts with the topic "6 weird habits/facts/dislikes about yourself" and people who get tagged MUST write a journal about their 6 weird habits/facts/dislikes as well as state this rule clearly. In the end, you need to choose the next 6 people to be tagged and list their names. Don't forget to leave a comment that says "you are tagged" in their deviant page comments and tell them to read yours . . .<br />
<br />
1.) i like the scent of old cars. lD<br />
<br />
2.) i eat star burst with the wrapper on (although that can't be good, can it <img src="http://e.deviantart.com/emoticons/e/eek.gif" width="15" height="15" alt=":O" title=":O (Eek)" />)<br />
<br />
3.) i look skinnier than i weigh >_>;;<br />
<br />
4.) im happy being an outcast from the school<br />
<br />
5.) i utterly suck at drawing matt groening's style 8D;;<br />
<br />
6.) i usually chew on finger joints for an onimous reason n.n<br />
<br />
not as interesting, but at least you know a bit about me <img src="http://e.deviantart.com/emoticons/letters/=p.gif" width="15" height="15" alt=":P" title=":P (Lick)" /><br />
i tagggg:<br />
<br />
<a href="http://mittster500.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/m/i/mittster500.gif" width="50" height="50" alt=":iconmittster500:" title="mittster500"/></a> <a href="http://chibiharrypotter.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/c/h/chibiharrypotter.gif" width="50" height="50" alt=":iconchibiharrypotter:" title="chibiharrypotter"/></a> <a href="http://dragontears555.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/d/r/dragontears555.gif" width="50" height="50" alt=":icondragontears555:" title="dragontears555"/></a><br />
<a href="http://darrie1127.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/d/a/darrie1127.gif" width="50" height="50" alt=":icondarrie1127:" title="darrie1127"/></a> <a href="http://kranlin.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/r/kranlin.png" width="50" height="50" alt=":iconkranlin:" title="kranlin"/></a> <a href="http://katgirl123.deviantart.com/"><img class="avatar" src="http://a.deviantart.com/avatars/k/a/katgirl123.gif" width="50" height="50" alt=":iconkatgirl123:" title="katgirl123"/></a><br />
<br />
wewt.<br /><br /> ]]></description>
                <author>~manafimaster</author>
            </item>
    </channel>
</rss>